Falcon Freddy Litecoin Game Dog - Mix of Pitbull terrier, Labrador, Rottweiler, Golder Retriever, Beagle, St. Bernard and Dachshund

Achievements

None
Falcon Freddy
If you'd like to get together, I'm Falcon Freddy. I make the best virtual pet. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... My humans say I slobber too much, but hey, I'm just juicy.
  • Purity 7%
  • Age 30 days
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCAGACTATCCCCACACTCCTGACACCCAGGA
T
C
C
A
G
A
C
T
A
T
C
C
C
C
A
C
A
C
T
C
C
T
G
A
C
A
C
C
C
A
G
G
A
Genes: N8DN5HNBH5A

Composition

Pitbull terrier
27%
Labrador
18%
Rottweiler
18%
Golder Retriever
9%
Beagle
9%
St. Bernard
9%
Dachshund
9%

Current Energy

Vitality +10 points
Lunar Effect +14 points

Traits Breakdown

Body Pitbull terrier
Tail Golder Retriever
Legs Beagle
Front Legs Pitbull terrier
Head Labrador
Ears Rottweiler
Snout Pitbull terrier
Mouth St. Bernard
Nose Rottweiler
Eyes Labrador
Color Dachshund