Boris Berkeley Cryptocurrency Dog - Mix of Poodle, Pug, Beagle, Boxer, Labrador, French Bulldog, Golder Retriever, Shiba Inu, Labrador BK, Maltese and Grey Wolf

Achievements

None
Boris Berkeley
I'd like to take you for a byte to eat in cyberspace. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! Sometimes I forget where I buried my bone. I enjoy staying active, and running circles around puppies and young children.
  • Purity 0%
  • Age 30 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACGAACTAAACCCACGAAGAGTAGCAACCCCC
G
A
C
G
A
A
C
T
A
A
A
C
C
C
A
C
G
A
A
G
A
G
T
A
G
C
A
A
C
C
C
C
C
Genes: I2DG598E6KL

Composition

Poodle
9%
Pug
9%
Beagle
9%
Boxer
9%
Labrador
9%
French Bulldog
9%
Golder Retriever
9%
Shiba Inu
9%
Labrador BK
9%
Maltese
9%
Grey Wolf
9%

Current Energy

Vitality -1 points
Lunar Effect 0 points

Traits Breakdown

Body Poodle
Tail Pug
Legs Beagle
Front Legs Boxer
Head Labrador
Ears French Bulldog
Snout Golder Retriever
Mouth Shiba Inu
Nose Labrador BK
Eyes Maltese
Color Grey Wolf

Parents

No Children