Maria Meggie Litecoin Dog - Mix of St. Bernard, Husky, Poodle, Boxer, Pitbull terrier, Grey Wolf, Beagle, Golder Retriever and Maltese

Achievements

None
Maria Meggie
Hi! I'm Maria Meggie! My humans say I slobber too much, but hey, I'm just juicy. Power outages and computer viruses scare me! I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! If I had to pick a favorite food it would be a hot-dog, because you are what you eat!
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • St. Bernard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACTGAACATGAAACACATCCCCCCTAAGAACC
G
A
C
T
G
A
A
C
A
T
G
A
A
A
C
A
C
A
T
C
C
C
C
C
C
T
A
A
G
A
A
C
C
Genes: IB4BG4NLD8K

Composition

St. Bernard
18%
Husky
18%
Poodle
9%
Boxer
9%
Pitbull terrier
9%
Grey Wolf
9%
Beagle
9%
Golder Retriever
9%
Maltese
9%

Current Energy

Vitality -27 points
Lunar Effect 0 points

Traits Breakdown

Body Poodle
Tail St. Bernard
Legs Husky
Front Legs St. Bernard
Head Boxer
Ears Husky
Snout Pitbull terrier
Mouth Grey Wolf
Nose Beagle
Eyes Golder Retriever
Color Maltese