Prince of Barkness Paris Litecoin Dog - Mix of Golder Retriever, Dachshund, Labrador, Rottweiler, Schnauzer, Labrador BK, Pitbull terrier, St. Bernard, Pug and Beagle

Achievements

None
Prince of Barkness Paris
I hate it when humans put the lid down. You'll find me walking into my favorite pet store like I own the place. I do, don't I? I like it when you're frisky. I need laid otherwise I'm going to start agreeing with Grumpy Cat.
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGACCACACATAAGAGCAAGATCCTGAGAACTA
G
G
A
C
C
A
C
A
C
A
T
A
A
G
A
G
C
A
A
G
A
T
C
C
T
G
A
G
A
A
C
T
A
Genes: A5HC868NB2D

Composition

Golder Retriever
18%
Dachshund
9%
Labrador
9%
Rottweiler
9%
Schnauzer
9%
Labrador BK
9%
Pitbull terrier
9%
St. Bernard
9%
Pug
9%
Beagle
9%

Current Energy

Vitality -43 points
Lunar Effect +8 points

Traits Breakdown

Body Dachshund
Tail Labrador
Legs Rottweiler
Front Legs Schnauzer
Head Golder Retriever
Ears Labrador BK
Snout Golder Retriever
Mouth Pitbull terrier
Nose St. Bernard
Eyes Pug
Color Beagle