Shoe String Shadow Bitcoin Dog - Mix of French Bulldog, Shiba Inu, Pug, Pitbull terrier, Grey Wolf, Boxer, Poodle, Dachshund, Labrador, Border Collie and Schnauzer

Achievements

None
Shoe String Shadow
What's up? I'm Shoe String Shadow. The Ethernet where I live, rocks. If you enjoy growling through fences as much as I do, we should get together. I've had my nose rubbed in 'it' more than once. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from??
  • Purity 0%
  • Age 3 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAGTAGAATCCCCCAACGACGGACCATACATA
C
G
A
G
T
A
G
A
A
T
C
C
C
C
C
A
A
C
G
A
C
G
G
A
C
C
A
T
A
C
A
T
A
Genes: 9E2NLGIA5JC

Composition

French Bulldog
9%
Shiba Inu
9%
Pug
9%
Pitbull terrier
9%
Grey Wolf
9%
Boxer
9%
Poodle
9%
Dachshund
9%
Labrador
9%
Border Collie
9%
Schnauzer
9%

Current Energy

Vitality -35 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Shiba Inu
Legs Pug
Front Legs Pitbull terrier
Head Grey Wolf
Ears Boxer
Snout Poodle
Mouth Dachshund
Nose Labrador
Eyes Border Collie
Color Schnauzer

Parents

No Children