Nosey Nitro Crypto Dog - Mix of Shiba Inu, Pug, Poodle, Dachshund, Border Collie, Yorkshire Terrier and Schnauzer

Achievements

None
Nosey Nitro
I keep my well-built figure with zeros and ones. My favorite place in the world is the dog park. So many smells! I hate it when my humans fool me with a pill in peanut butter! As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 12%
  • Age 32 days
  • Racing Exp 0
  • Shiba Inu 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACGGAGAATACGTAGAATTAGTAATAGTAGTA
G
A
C
G
G
A
G
A
A
T
A
C
G
T
A
G
A
A
T
T
A
G
T
A
A
T
A
G
T
A
G
T
A
Genes: IA2JE2FECEE

Composition

Shiba Inu
36%
Pug
18%
Poodle
9%
Dachshund
9%
Border Collie
9%
Yorkshire Terrier
9%
Schnauzer
9%

Current Energy

Vitality +18 points
Lunar Effect -4 points

Traits Breakdown

Body Poodle
Tail Dachshund
Legs Pug
Front Legs Border Collie
Head Shiba Inu
Ears Pug
Snout Yorkshire Terrier
Mouth Shiba Inu
Nose Schnauzer
Eyes Shiba Inu
Color Shiba Inu