Interference Isabelle Bitcoin Dog - Mix of Labrador, Grey Wolf, Shiba Inu, Boxer, Pug, Border Collie, Labrador BK, Pitbull terrier, Schnauzer and Yorkshire Terrier

Achievements

None
Interference Isabelle
Hey dawg! I'm Interference Isabelle. I'd like to help you shed your coat, baby. You'll find me walking into my favorite pet store like I own the place. I do, don't I? I've been known to run with bad dogs. Aggressive dogs that don't let 'me be me' frustrate me.
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCGTAAACGAACCACCATACGCATCCATATTA
C
C
C
G
T
A
A
A
C
G
A
A
C
C
A
C
C
A
T
A
C
G
C
A
T
C
C
A
T
A
T
T
A
Genes: LEG255J6NCF

Composition

Labrador
18%
Grey Wolf
9%
Shiba Inu
9%
Boxer
9%
Pug
9%
Border Collie
9%
Labrador BK
9%
Pitbull terrier
9%
Schnauzer
9%
Yorkshire Terrier
9%

Current Energy

Vitality -32 points
Lunar Effect 0 points

Traits Breakdown

Body Grey Wolf
Tail Shiba Inu
Legs Boxer
Front Legs Pug
Head Labrador
Ears Labrador
Snout Border Collie
Mouth Labrador BK
Nose Pitbull terrier
Eyes Schnauzer
Color Yorkshire Terrier