Tess Tex Litecoin Dog - Mix of Labrador BK, Poodle, Golder Retriever, Yorkshire Terrier, Corgi, Boxer, Shiba Inu and Beagle

Achievements

None
Tess Tex
My favorite treat is to steal the pepperoni off of pizza. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I hate having to wear foo-foo clothes and ribbons in my fur. I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.
  • Purity 6%
  • Age 30 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCATTAGACGACAGAAGCAGAGCAAACGTACTA
G
C
A
T
T
A
G
A
C
G
A
C
A
G
A
A
G
C
A
G
A
G
C
A
A
A
C
G
T
A
C
T
A
Genes: 6FII8O86GED

Composition

Labrador BK
18%
Poodle
18%
Golder Retriever
18%
Yorkshire Terrier
9%
Corgi
9%
Boxer
9%
Shiba Inu
9%
Beagle
9%

Current Energy

Vitality +21 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador BK
Tail Yorkshire Terrier
Legs Poodle
Front Legs Poodle
Head Golder Retriever
Ears Corgi
Snout Golder Retriever
Mouth Labrador BK
Nose Boxer
Eyes Shiba Inu
Color Beagle

Parents

No Children