Gray Fox Great Tiger Digital Cryptocurrency Dog - Mix of Rottweiler, Labrador BK, Pug, Poodle, Pitbull terrier, Beagle, Maltese and German Shepard

Achievements

None
Gray Fox Great Tiger
Nice to meet you! I'm Gray Fox Great Tiger. In my digital world, cats aren't the only ones who hack. You'll find me walking into my favorite pet store like I own the place. I do, don't I? I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 6%
  • Age 3 months
  • Racing Exp 0
  • Rottweiler 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGCAGACTCCCACCTACACACCGCATCACAC
G
A
A
G
C
A
G
A
C
T
C
C
C
A
C
C
T
A
C
A
C
A
C
C
G
C
A
T
C
A
C
A
C
Genes: 26INHDHK67H

Composition

Rottweiler
27%
Labrador BK
18%
Pug
9%
Poodle
9%
Pitbull terrier
9%
Beagle
9%
Maltese
9%
German Shepard
9%

Current Energy

Vitality -45 points
Lunar Effect -8 points

Traits Breakdown

Body Pug
Tail Labrador BK
Legs Poodle
Front Legs Pitbull terrier
Head Rottweiler
Ears Beagle
Snout Rottweiler
Mouth Maltese
Nose Labrador BK
Eyes German Shepard
Color Rottweiler