Chessie Colby Bitcoin Dog - Mix of Boxer, Pug, Poodle, Grey Wolf, Rottweiler, Yorkshire Terrier, Golder Retriever and Schnauzer

Achievements

None
Chessie Colby
Suh...you good? Chessie Colby here. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! My favorite song is "Who Let the Dogs Out?" It was me :) I need to find someone tuff to help me protect our pups from that scheming mailman!
  • Purity 11%
  • Age 32 days
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAAGACAACAACAACCCCCACTTAAGAATAGAA
G
A
A
G
A
C
A
A
C
A
A
C
A
A
C
C
C
C
C
A
C
T
T
A
A
G
A
A
T
A
G
A
A
Genes: 2IGGGLHF8C2

Composition

Boxer
27%
Pug
18%
Poodle
9%
Grey Wolf
9%
Rottweiler
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Schnauzer
9%

Current Energy

Vitality -12 points
Lunar Effect -8 points

Traits Breakdown

Body Pug
Tail Poodle
Legs Boxer
Front Legs Boxer
Head Boxer
Ears Grey Wolf
Snout Rottweiler
Mouth Yorkshire Terrier
Nose Golder Retriever
Eyes Schnauzer
Color Pug

Parents

No Children