Chessie Colby Bitcoin Dog - Mix of Boxer, Pug, Poodle, Grey Wolf, Rottweiler, Yorkshire Terrier, Golder Retriever and Schnauzer

Achievements

None
Chessie Colby
Suh...you good? Chessie Colby here. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! My favorite song is "Who Let the Dogs Out?" It was me :) I need to find someone tuff to help me protect our pups from that scheming mailman!
  • Purity 11%
  • Age 3 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGACAACAACAACCCCCACTTAAGAATAGAA
G
A
A
G
A
C
A
A
C
A
A
C
A
A
C
C
C
C
C
A
C
T
T
A
A
G
A
A
T
A
G
A
A
Genes: 2IGGGLHF8C2

Composition

Boxer
27%
Pug
18%
Poodle
9%
Grey Wolf
9%
Rottweiler
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Schnauzer
9%

Current Energy

Vitality -53 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Poodle
Legs Boxer
Front Legs Boxer
Head Boxer
Ears Grey Wolf
Snout Rottweiler
Mouth Yorkshire Terrier
Nose Golder Retriever
Eyes Schnauzer
Color Pug