Finnegan Floyd Crypto Dog - Mix of Beagle, Rottweiler, Golder Retriever, Poodle, Dachshund, German Shepard, Labrador and Border Collie

Achievements

None
Finnegan Floyd
They call me Finnegan Floyd. What's your name? I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I'm going kill that damn Nyan Cat if I can catch it. If you are looking for companionship without commitment, so am I.
  • Purity 8%
  • Age 32 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACGGATCACTACTACACCCAAGAAGACACTAC
G
A
C
G
G
A
T
C
A
C
T
A
C
T
A
C
A
C
C
C
A
A
G
A
A
G
A
C
A
C
T
A
C
Genes: IA7DDH588HJ

Composition

Beagle
18%
Rottweiler
18%
Golder Retriever
18%
Poodle
9%
Dachshund
9%
German Shepard
9%
Labrador
9%
Border Collie
9%

Current Energy

Vitality +17 points
Lunar Effect -14 points

Traits Breakdown

Body Poodle
Tail Dachshund
Legs German Shepard
Front Legs Beagle
Head Beagle
Ears Rottweiler
Snout Labrador
Mouth Golder Retriever
Nose Golder Retriever
Eyes Rottweiler
Color Border Collie

Parents

No Children