Tesla Tank Crypto Dog - Mix of Rottweiler, Pug, Labrador, German Shepard, Border Collie, Boxer and French Bulldog

Achievements

None
Tesla Tank
They call me Tesla Tank. What's your name? I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I'm going kill that damn Nyan Cat if I can catch it. If you are looking for companionship without commitment, so am I.
  • Purity 9%
  • Age 59 days
  • Racing Exp 0
  • Rottweiler 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAATCACCACACGAATACAACCCACGACACCAC
G
A
A
T
C
A
C
C
A
C
A
C
G
A
A
T
A
C
A
A
C
C
C
A
C
G
A
C
A
C
C
A
C
Genes: 275H2JG59HH

Composition

Rottweiler
27%
Pug
18%
Labrador
18%
German Shepard
9%
Border Collie
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality -2 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail German Shepard
Legs Labrador
Front Legs Rottweiler
Head Pug
Ears Border Collie
Snout Boxer
Mouth Labrador
Nose French Bulldog
Eyes Rottweiler
Color Rottweiler