Coal Chewbarka Litecoin Dog - Mix of Corgi, German Shepard, Schnauzer, Rottweiler, St. Bernard, Boxer, Poodle, Maltese, Golder Retriever and Beagle

Achievements

None
Coal Chewbarka
Hi! My name is Coal Chewbarka. Here in cyberspace, I ain't got much use for a floppy disc. I'm not into dog collars, unless you're into S & M. My favorite treat is to steal the pepperoni off of pizza. I never met a leg I didn't want to hump. It doesn't matter to me which team I play for... I just like tail.
  • Purity 1%
  • Age 59 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAAGCATACACTGAAACGACACCAGAAGCCTA
T
C
A
A
G
C
A
T
A
C
A
C
T
G
A
A
A
C
G
A
C
A
C
C
A
G
A
A
G
C
C
T
A
Genes: 7OCHBGIK8OD

Composition

Corgi
18%
German Shepard
9%
Schnauzer
9%
Rottweiler
9%
St. Bernard
9%
Boxer
9%
Poodle
9%
Maltese
9%
Golder Retriever
9%
Beagle
9%

Current Energy

Vitality -2 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Schnauzer
Front Legs Rottweiler
Head St. Bernard
Ears Boxer
Snout Poodle
Mouth Maltese
Nose Golder Retriever
Eyes Corgi
Color Beagle