Tailgate Trudy Litecoin Dog - Mix of Rottweiler, Shiba Inu, Poodle, Dachshund, Boxer, Border Collie, Maltese and Pug

Achievements

None
Tailgate Trudy
Hi! My name is Tailgate Trudy. Here in cyberspace, I ain't got much use for a floppy disc. I'm not into dog collars, unless you're into S & M. My favorite treat is to steal the pepperoni off of pizza. I never met a leg I didn't want to hump. It doesn't matter to me which team I play for... I just like tail.
  • Purity 4%
  • Age 30 days
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACGTAGGAAACTACGACCACACCGTAGACGAA
C
A
C
G
T
A
G
G
A
A
A
C
T
A
C
G
A
C
C
A
C
A
C
C
G
T
A
G
A
C
G
A
A
Genes: HEAGJIHKEI2

Composition

Rottweiler
18%
Shiba Inu
18%
Poodle
18%
Dachshund
9%
Boxer
9%
Border Collie
9%
Maltese
9%
Pug
9%

Current Energy

Vitality +30 points
Lunar Effect +2 points

Traits Breakdown

Body Rottweiler
Tail Shiba Inu
Legs Dachshund
Front Legs Boxer
Head Border Collie
Ears Poodle
Snout Rottweiler
Mouth Maltese
Nose Shiba Inu
Eyes Poodle
Color Pug

Parents

No Children