Kelly Kato Litecoin Dog - Mix of Corgi, German Shepard, Dachshund, Husky, Border Collie, Schnauzer, Golder Retriever, Grey Wolf, Maltese and Labrador BK

Achievements

None
Kelly Kato
Nyan Cat is my best friend here in the cyberspace. I don't appreciate being around bores who bark too much. I'm going kill that damn Nyan Cat if I can catch it. My favorite chews are underwear and rawhide...the rawhide lasts longer. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 1%
  • Age 30 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAGGAACAAGCTACATAAGCAGACCCACCGCA
T
C
A
G
G
A
A
C
A
A
G
C
T
A
C
A
T
A
A
G
C
A
G
A
C
C
C
A
C
C
G
C
A
Genes: 7A4OJCO8LK6

Composition

Corgi
18%
German Shepard
9%
Dachshund
9%
Husky
9%
Border Collie
9%
Schnauzer
9%
Golder Retriever
9%
Grey Wolf
9%
Maltese
9%
Labrador BK
9%

Current Energy

Vitality +47 points
Lunar Effect -2 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs Husky
Front Legs Corgi
Head Border Collie
Ears Schnauzer
Snout Corgi
Mouth Golder Retriever
Nose Grey Wolf
Eyes Maltese
Color Labrador BK

Parents

No Children