Starr Sweetie Litecoin Dog - Mix of Rottweiler, Grey Wolf, German Shepard, Labrador, Golder Retriever, Husky, Border Collie, Boxer, Maltese and French Bulldog

Achievements

None
Starr Sweetie
Nyan Cat is my best friend here in the cyberspace. I don't appreciate being around bores who bark too much. I'm going kill that damn Nyan Cat if I can catch it. My favorite chews are underwear and rawhide...the rawhide lasts longer. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 3%
  • Age 59 days
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTCACCAAGAACATACAACACCCGACACCAC
C
C
C
T
C
A
C
C
A
A
G
A
A
C
A
T
A
C
A
A
C
A
C
C
C
G
A
C
A
C
C
A
C
Genes: L7584JGK9HH

Composition

Rottweiler
18%
Grey Wolf
9%
German Shepard
9%
Labrador
9%
Golder Retriever
9%
Husky
9%
Border Collie
9%
Boxer
9%
Maltese
9%
French Bulldog
9%

Current Energy

Vitality +26 points
Lunar Effect -4 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Labrador
Front Legs Golder Retriever
Head Husky
Ears Border Collie
Snout Boxer
Mouth Maltese
Nose French Bulldog
Eyes Rottweiler
Color Rottweiler