Ryu Rosy Litecoin Game Dog - Mix of German Shepard, Border Collie, Labrador BK, Golder Retriever and Yorkshire Terrier

Achievements

None
Ryu Rosy
Ryu Rosy here, let's shake. My favorite way to relax is to be scratched on my belly. I hate it when my humans fool me with a pill in peanut butter! After introductory sniffing, I like some licking. If I can't reach it to clean it myself, it doesn't need cleaning! I just want a snuggle buddy with a nice, soft coat.
  • Purity 29%
  • Age 59 days
  • Racing Exp 0
  • German Shepard 55%
  • 0 races
  • Gen 22
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCAGCATACAGATCATTATCATACTCATCA
T
C
A
T
C
A
G
C
A
T
A
C
A
G
A
T
C
A
T
T
A
T
C
A
T
A
C
T
C
A
T
C
A
Genes: 776J87F7J77

Composition

German Shepard
55%
Border Collie
18%
Labrador BK
9%
Golder Retriever
9%
Yorkshire Terrier
9%

Current Energy

Vitality 0 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs Labrador BK
Front Legs Border Collie
Head Golder Retriever
Ears German Shepard
Snout Yorkshire Terrier
Mouth German Shepard
Nose Border Collie
Eyes German Shepard
Color German Shepard