Hobbit Hecuba Litecoin Game Dog - Mix of French Bulldog, Schnauzer, German Shepard, Maltese, Golder Retriever, Dachshund, Beagle, Corgi and Border Collie

Achievements

None
Hobbit Hecuba
Hobbit Hecuba here, let's shake. My favorite way to relax is to be scratched on my belly. I hate it when my humans fool me with a pill in peanut butter! After introductory sniffing, I like some licking. I just want a snuggle buddy with a nice, soft coat.
  • Purity 3%
  • Age 30 days
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAACCAGACGAGGACGAATACTAAGCTACATA
T
C
A
A
C
C
A
G
A
C
G
A
G
G
A
C
G
A
A
T
A
C
T
A
A
G
C
T
A
C
A
T
A
Genes: 7K89A9CDOJC

Composition

French Bulldog
18%
Schnauzer
18%
German Shepard
9%
Maltese
9%
Golder Retriever
9%
Dachshund
9%
Beagle
9%
Corgi
9%
Border Collie
9%

Current Energy

Vitality +31 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Maltese
Legs Golder Retriever
Front Legs French Bulldog
Head Dachshund
Ears French Bulldog
Snout Schnauzer
Mouth Beagle
Nose Corgi
Eyes Border Collie
Color Schnauzer

Parents

No Children