Morty Miko Crypto Game Dog - Mix of Pug, Labrador, Rottweiler, Corgi, Husky, Maltese and Border Collie

Achievements

None
Morty Miko
If you enjoy growling through fences as much as I do, we should get together. I enjoy going to the dog park to see all my friends! I don't mind sharing my bed with someone I just met, if we can cuddle. I hate it when my humans fart and they blame me!
  • Purity 12%
  • Age 59 days
  • Racing Exp 0
  • Pug 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAACCACACGAAAGCACACCAGAAACCTAC
G
A
A
G
A
A
C
C
A
C
A
C
G
A
A
A
G
C
A
C
A
C
C
A
G
A
A
A
C
C
T
A
C
Genes: 225H2O452KJ

Composition

Pug
36%
Labrador
18%
Rottweiler
9%
Corgi
9%
Husky
9%
Maltese
9%
Border Collie
9%

Current Energy

Vitality -2 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Labrador
Front Legs Rottweiler
Head Pug
Ears Corgi
Snout Husky
Mouth Labrador
Nose Pug
Eyes Maltese
Color Border Collie