Kallie Katie Crypto Game Dog - Mix of Dachshund, Golder Retriever, Pug, Boxer, Shiba Inu, French Bulldog, Corgi and Labrador

Achievements

None
Kallie Katie
If you enjoy growling through fences as much as I do, we should get together. I enjoy going to the dog park to see all my friends! I don't mind sharing my bed with someone I just met, if we can cuddle. I hate it when my humans fart and they blame me!
  • Purity 6%
  • Age 30 days
  • Racing Exp 0
  • Dachshund 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAGAAGGAAACGTACGAGGAAGCCCAAGAGGA
A
G
A
G
A
A
G
G
A
A
A
C
G
T
A
C
G
A
G
G
A
A
G
C
C
C
A
A
G
A
G
G
A
Genes: 82AGE9AO58A

Composition

Dachshund
27%
Golder Retriever
18%
Pug
9%
Boxer
9%
Shiba Inu
9%
French Bulldog
9%
Corgi
9%
Labrador
9%

Current Energy

Vitality +19 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Pug
Legs Dachshund
Front Legs Boxer
Head Shiba Inu
Ears French Bulldog
Snout Dachshund
Mouth Corgi
Nose Labrador
Eyes Golder Retriever
Color Dachshund

Parents

No Children