Powder Pooh-Bear Bitcoin Game Dog - Mix of Grey Wolf, Husky, Labrador, Golder Retriever, Boxer, Pug, Border Collie, Maltese, Corgi and Rottweiler

Achievements

None
Powder Pooh-Bear
I'm not a bad dog, my data is just configured that way. I'm sick of having my nails clipped, those are to help me dig! My 'G' spot is under my chin...scratch me there and I'll growl softly. I love unconditionally. I'm just looking for some puppy love.
  • Purity 1%
  • Age 30 days
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACACCAAGAAACGAACCCTACACCAGCCCCCAC
A
C
A
C
C
A
A
G
A
A
A
C
G
A
A
C
C
C
T
A
C
A
C
C
A
G
C
C
C
C
C
A
C
Genes: 458G2LJKOLH

Composition

Grey Wolf
18%
Husky
9%
Labrador
9%
Golder Retriever
9%
Boxer
9%
Pug
9%
Border Collie
9%
Maltese
9%
Corgi
9%
Rottweiler
9%

Current Energy

Vitality +17 points
Lunar Effect +2 points

Traits Breakdown

Body Husky
Tail Labrador
Legs Golder Retriever
Front Legs Boxer
Head Pug
Ears Grey Wolf
Snout Border Collie
Mouth Maltese
Nose Corgi
Eyes Grey Wolf
Color Rottweiler