Roxanne Rover Bitcoin Game Dog - Mix of Pug, Corgi, French Bulldog, Rottweiler, Poodle, Labrador and Golder Retriever

Achievements

None
Roxanne Rover
I'm not a bad dog, my data is just configured that way. I'm sick of having my nails clipped, those are to help me dig! My 'G' spot is under my chin...scratch me there and I'll growl softly. I love unconditionally. I'm just looking for some puppy love.
  • Purity 12%
  • Age 3 months
  • Racing Exp 0
  • Pug 36%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAACGACACGAAAGCGACCCAGAAAGAAGC
G
A
A
G
A
A
C
G
A
C
A
C
G
A
A
A
G
C
G
A
C
C
C
A
G
A
A
A
G
A
A
G
C
Genes: 229H2OI528O

Composition

Pug
36%
Corgi
18%
French Bulldog
9%
Rottweiler
9%
Poodle
9%
Labrador
9%
Golder Retriever
9%

Current Energy

Vitality -40 points
Lunar Effect +4 points

Traits Breakdown

Body Pug
Tail Pug
Legs French Bulldog
Front Legs Rottweiler
Head Pug
Ears Corgi
Snout Poodle
Mouth Labrador
Nose Pug
Eyes Golder Retriever
Color Corgi