Buster Biscuit Bitcoin Dog - Mix of Border Collie, Dachshund, Pug, Labrador, Rottweiler, Grey Wolf, Corgi, Poodle and Husky

Achievements

None
Buster Biscuit
Hi! I'm Buster Biscuit! I hate it when I am not the center of attention. My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I'm looking for some ruff play. Wanna bite me?
  • Purity 3%
  • Age 2 months
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGAATACCCACACGGACCCGGAAGCGACACA
T
A
C
G
A
A
T
A
C
C
C
A
C
A
C
G
G
A
C
C
C
G
G
A
A
G
C
G
A
C
A
C
A
Genes: J2J5HALAOI4

Composition

Border Collie
18%
Dachshund
18%
Pug
9%
Labrador
9%
Rottweiler
9%
Grey Wolf
9%
Corgi
9%
Poodle
9%
Husky
9%

Current Energy

Vitality +18 points
Lunar Effect -14 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Border Collie
Front Legs Labrador
Head Rottweiler
Ears Dachshund
Snout Grey Wolf
Mouth Dachshund
Nose Corgi
Eyes Poodle
Color Husky