Tom Tizzy Bitcoin Dog - Mix of Labrador BK, Pitbull terrier, St. Bernard, Boxer, Shiba Inu, German Shepard and Dachshund

Achievements

None
Tom Tizzy
Hi! I'm Tom Tizzy! I hate it when I am not the center of attention. My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I'm looking for some ruff play. Wanna bite me?
  • Purity 6%
  • Age 33 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAGTATCCTGAAACTCAGGAAACGCATCCTGA
G
C
A
G
T
A
T
C
C
T
G
A
A
A
C
T
C
A
G
G
A
A
A
C
G
C
A
T
C
C
T
G
A
Genes: 6ENBG7AG6NB

Composition

Labrador BK
18%
Pitbull terrier
18%
St. Bernard
18%
Boxer
18%
Shiba Inu
9%
German Shepard
9%
Dachshund
9%

Current Energy

Vitality +9 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador BK
Tail Shiba Inu
Legs Pitbull terrier
Front Legs St. Bernard
Head Boxer
Ears German Shepard
Snout Dachshund
Mouth Boxer
Nose Labrador BK
Eyes Pitbull terrier
Color St. Bernard

Parents

No Children