Guido Gage Litecoin Dog - Mix of Grey Wolf, Beagle, Corgi, Pug, Schnauzer, French Bulldog, Golder Retriever, Boxer, Labrador BK, Maltese and Husky

Achievements

Racer
Podium Champion
Guido Gage
Steak is my absolute favorite, but I prefer to eat chicken for my health. I really dislike stinky flea collars. I've always had a crush on Lassie. I like to respond to sad puppy eyes with sad puppy eyes of my own. I'm trying to find a partner in crime to help me dig through the trash for the good stuff.
  • Purity 0%
  • Age 31 days
  • Racing Exp 30
  • Mixed-breed
  • 12 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

12 races   |
  • 1 1 1
 Best Time14.88 sec
No rank  Racing *** Pts
25.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCCTAAGCGAAATACGAAGAAACGCAACCACA
C
C
C
C
T
A
A
G
C
G
A
A
A
T
A
C
G
A
A
G
A
A
A
C
G
C
A
A
C
C
A
C
A
Genes: LDO2C98G6K4

Composition

Grey Wolf
9%
Beagle
9%
Corgi
9%
Pug
9%
Schnauzer
9%
French Bulldog
9%
Golder Retriever
9%
Boxer
9%
Labrador BK
9%
Maltese
9%
Husky
9%

Current Energy

Vitality +3 points
Lunar Effect -4 points

Traits Breakdown

Body Grey Wolf
Tail Beagle
Legs Corgi
Front Legs Pug
Head Schnauzer
Ears French Bulldog
Snout Golder Retriever
Mouth Boxer
Nose Labrador BK
Eyes Maltese
Color Husky

Parents

No Children

Photos

Bitcoin dog racing cryptocurrency dog racing online dog racing