Zoe Zack Litecoin Dog - Mix of Labrador, Labrador BK, German Shepard, Rottweiler, Husky, Dachshund, French Bulldog and Maltese

Achievements

None
Zoe Zack
Steak is my absolute favorite, but I prefer to eat chicken for my health. I really dislike stinky flea collars. I've always had a crush on Lassie. I like to respond to sad puppy eyes with sad puppy eyes of my own. I'm trying to find a partner in crime to help me dig through the trash for the good stuff.
  • Purity 6%
  • Age 2 months
  • Racing Exp 0
  • Labrador 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACCATCAGCACACACAGGACCACGACCAACC
G
C
A
C
C
A
T
C
A
G
C
A
C
A
C
A
C
A
G
G
A
C
C
A
C
G
A
C
C
A
A
C
C
Genes: 6576H4A595K

Composition

Labrador
27%
Labrador BK
18%
German Shepard
9%
Rottweiler
9%
Husky
9%
Dachshund
9%
French Bulldog
9%
Maltese
9%

Current Energy

Vitality +22 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Labrador
Legs German Shepard
Front Legs Labrador BK
Head Rottweiler
Ears Husky
Snout Dachshund
Mouth Labrador
Nose French Bulldog
Eyes Labrador
Color Maltese