Onie Old Yeller Bitcoin Dog - Mix of Pug, Border Collie, Boxer, Labrador BK, Labrador, Dachshund, Rottweiler and Yorkshire Terrier

Achievements

None
Onie Old Yeller
My name is Onie Old Yeller and I'd really like to sniff you. As a good digital dog, my humans give me virtually everything. When my human brushes my coat, I get frisky! I need to find someone tuff to help me protect our pups from that scheming mailman!
  • Purity 6%
  • Age 2 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGAATACCCAGGAAACAACTACGAACACTTA
G
C
A
G
A
A
T
A
C
C
C
A
G
G
A
A
A
C
A
A
C
T
A
C
G
A
A
C
A
C
T
T
A
Genes: 62J5AGGJ2HF

Composition

Pug
18%
Border Collie
18%
Boxer
18%
Labrador BK
9%
Labrador
9%
Dachshund
9%
Rottweiler
9%
Yorkshire Terrier
9%

Current Energy

Vitality +17 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Border Collie
Front Legs Labrador
Head Dachshund
Ears Boxer
Snout Boxer
Mouth Border Collie
Nose Pug
Eyes Rottweiler
Color Yorkshire Terrier