Deuce Dewey Bitcoin Dog - Mix of Labrador BK, Beagle, Dachshund, Pug, Golder Retriever, Grey Wolf, Border Collie and Shiba Inu

Achievements

None
Deuce Dewey
My name is Deuce Dewey and I'd really like to sniff you. As a good digital dog, my humans give me virtually everything. When my human brushes my coat, I get frisky! My human's feet are definitely the greatest smell ever. Especially after a long day at work! I need to find someone tuff to help me protect our pups from that scheming mailman!
  • Purity 8%
  • Age 32 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAAGCAAGACCCTACCTACTAGCAGTAGGAGGA
G
A
A
G
C
A
A
G
A
C
C
C
T
A
C
C
T
A
C
T
A
G
C
A
G
T
A
G
G
A
G
G
A
Genes: 268LJDD6EAA

Composition

Labrador BK
18%
Beagle
18%
Dachshund
18%
Pug
9%
Golder Retriever
9%
Grey Wolf
9%
Border Collie
9%
Shiba Inu
9%

Current Energy

Vitality +36 points
Lunar Effect -14 points

Traits Breakdown

Body Pug
Tail Labrador BK
Legs Golder Retriever
Front Legs Grey Wolf
Head Border Collie
Ears Beagle
Snout Beagle
Mouth Labrador BK
Nose Shiba Inu
Eyes Dachshund
Color Dachshund

Parents

No Children