Niki Nutmeg Digital Cryptocurrency Game Dog - Mix of Labrador, Boxer, Yorkshire Terrier, Border Collie, German Shepard, Dachshund, French Bulldog and Maltese

Achievements

None
Niki Nutmeg
I live behind a firewall in the Machine. I am not above stealing food off humans' plates. Steak is my absolute favorite, but I prefer to eat chicken for my health. Aggressive dogs that don't let 'me be me' frustrate me. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 8%
  • Age 2 months
  • Racing Exp 0
  • Labrador 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTACCATACCCATCAAACAACGGACGACCAACC
T
T
A
C
C
A
T
A
C
C
C
A
T
C
A
A
A
C
A
A
C
G
G
A
C
G
A
C
C
A
A
C
C
Genes: F5J57GGA95K

Composition

Labrador
27%
Boxer
18%
Yorkshire Terrier
9%
Border Collie
9%
German Shepard
9%
Dachshund
9%
French Bulldog
9%
Maltese
9%

Current Energy

Vitality +16 points
Lunar Effect -4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Labrador
Legs Border Collie
Front Legs Labrador
Head German Shepard
Ears Boxer
Snout Boxer
Mouth Dachshund
Nose French Bulldog
Eyes Labrador
Color Maltese