Faulkner Flounder Digital Cryptocurrency Game Dog - Mix of Labrador, Pitbull terrier, Grey Wolf, Boxer, St. Bernard, Maltese, Yorkshire Terrier, Beagle and Labrador BK

Achievements

None
Faulkner Flounder
I live behind a firewall in the Machine. I am not above stealing food off humans' plates. Steak is my absolute favorite, but I prefer to eat chicken for my health. Aggressive dogs that don't let 'me be me' frustrate me. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 3%
  • Age 32 days
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCATCCCCCAACTGACCAACCTCCTTACTAGCA
C
C
A
T
C
C
C
C
C
A
A
C
T
G
A
C
C
A
A
C
C
T
C
C
T
T
A
C
T
A
G
C
A
Genes: 5NLGB5KNFD6

Composition

Labrador
18%
Pitbull terrier
18%
Grey Wolf
9%
Boxer
9%
St. Bernard
9%
Maltese
9%
Yorkshire Terrier
9%
Beagle
9%
Labrador BK
9%

Current Energy

Vitality +40 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Pitbull terrier
Legs Grey Wolf
Front Legs Boxer
Head St. Bernard
Ears Labrador
Snout Maltese
Mouth Pitbull terrier
Nose Yorkshire Terrier
Eyes Beagle
Color Labrador BK

Parents

No Children