Gretchen Gizmo Digital Cryptocurrency Dog - Mix of Beagle, Husky, Border Collie, Rottweiler, Schnauzer, German Shepard, Dachshund and St. Bernard

Achievements

None
Gretchen Gizmo
My 'G' spot is under my chin...scratch me there and I'll growl softly. My humans should try spending 8 hours a day in a crate! I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 4%
  • Age 2 months
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCTAACAATATCAGGATACTGACTAACATAC
C
A
C
C
T
A
A
C
A
A
T
A
T
C
A
G
G
A
T
A
C
T
G
A
C
T
A
A
C
A
T
A
C
Genes: HD4C7AJBD4J

Composition

Beagle
18%
Husky
18%
Border Collie
18%
Rottweiler
9%
Schnauzer
9%
German Shepard
9%
Dachshund
9%
St. Bernard
9%

Current Energy

Vitality -9 points
Lunar Effect +14 points

Traits Breakdown

Body Rottweiler
Tail Beagle
Legs Husky
Front Legs Schnauzer
Head German Shepard
Ears Dachshund
Snout Border Collie
Mouth St. Bernard
Nose Beagle
Eyes Husky
Color Border Collie