Amelie Amie Digital Cryptocurrency Dog - Mix of French Bulldog, St. Bernard, Corgi, Beagle, Dachshund, Pitbull terrier, Labrador and Labrador BK

Achievements

None
Amelie Amie
My 'G' spot is under my chin...scratch me there and I'll growl softly. My humans should try spending 8 hours a day in a crate! I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 6%
  • Age 31 days
  • Racing Exp 0
  • French Bulldog 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGATGAAGCCTATGACGAGGATCCCGACCAGCA
C
G
A
T
G
A
A
G
C
C
T
A
T
G
A
C
G
A
G
G
A
T
C
C
C
G
A
C
C
A
G
C
A
Genes: 9BODB9AN956

Composition

French Bulldog
27%
St. Bernard
18%
Corgi
9%
Beagle
9%
Dachshund
9%
Pitbull terrier
9%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -2 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail St. Bernard
Legs Corgi
Front Legs Beagle
Head St. Bernard
Ears French Bulldog
Snout Dachshund
Mouth Pitbull terrier
Nose French Bulldog
Eyes Labrador
Color Labrador BK

Parents

No Children