Nikki Nibby Bitcoin Game Dog - Mix of Dachshund, Maltese, Grey Wolf, Pug, Beagle, French Bulldog, Labrador BK, Border Collie, Shiba Inu and Schnauzer

Achievements

None
Nikki Nibby
They call me Nikki Nibby. What's your name? Ima Ethernet dog. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! My idea of romance would be to stroll through in the dog park then share a meaty bone with you.
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • Dachshund 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCCCCGAACTACGAGCAGGAGGATACGTAATA
A
C
C
C
C
C
G
A
A
C
T
A
C
G
A
G
C
A
G
G
A
G
G
A
T
A
C
G
T
A
A
T
A
Genes: KL2D96AAJEC

Composition

Dachshund
18%
Maltese
9%
Grey Wolf
9%
Pug
9%
Beagle
9%
French Bulldog
9%
Labrador BK
9%
Border Collie
9%
Shiba Inu
9%
Schnauzer
9%

Current Energy

Vitality -16 points
Lunar Effect +4 points

Traits Breakdown

Body Maltese
Tail Grey Wolf
Legs Pug
Front Legs Beagle
Head French Bulldog
Ears Labrador BK
Snout Dachshund
Mouth Dachshund
Nose Border Collie
Eyes Shiba Inu
Color Schnauzer

Parents

No Children