Queenie Queen Bitcoin Game Dog - Mix of Pitbull terrier, Golder Retriever, Corgi, Beagle, Shiba Inu, French Bulldog and Pug

Achievements

None
Queenie Queen
They call me Queenie Queen. What's your name? Ima Ethernet dog. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! My idea of romance would be to stroll through in the dog park then share a meaty bone with you.
  • Purity 11%
  • Age 3 months
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATCCTCCAGAGTAAGCAGCAGACGATCCGAA
C
T
A
T
C
C
T
C
C
A
G
A
G
T
A
A
G
C
A
G
C
A
G
A
C
G
A
T
C
C
G
A
A
Genes: DNN8EOO89N2

Composition

Pitbull terrier
27%
Golder Retriever
18%
Corgi
18%
Beagle
9%
Shiba Inu
9%
French Bulldog
9%
Pug
9%

Current Energy

Vitality -25 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Pitbull terrier
Legs Pitbull terrier
Front Legs Golder Retriever
Head Shiba Inu
Ears Corgi
Snout Corgi
Mouth Golder Retriever
Nose French Bulldog
Eyes Pitbull terrier
Color Pug