Tails Tiki Crypto Game Dog - Mix of Border Collie, Yorkshire Terrier, Grey Wolf, St. Bernard, Labrador BK, Golder Retriever, Labrador, Husky and Poodle

Achievements

None
Tails Tiki
I run on the information superhighway and haven't been hit by a car yet. Chasing anything that will run is so much fun, I could do that all day. I've been known to run with bad dogs. I don't like having to stay off the furniture. I'm not looking to hook up forever, just to have a little fun.
  • Purity 5%
  • Age 3 months
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTGAGCATACAGATTATTACCATACACAGAC
C
C
C
T
G
A
G
C
A
T
A
C
A
G
A
T
T
A
T
T
A
C
C
A
T
A
C
A
C
A
G
A
C
Genes: LB6J8FF5J4I

Composition

Border Collie
18%
Yorkshire Terrier
18%
Grey Wolf
9%
St. Bernard
9%
Labrador BK
9%
Golder Retriever
9%
Labrador
9%
Husky
9%
Poodle
9%

Current Energy

Vitality -12 points
Lunar Effect 0 points

Traits Breakdown

Body Grey Wolf
Tail St. Bernard
Legs Labrador BK
Front Legs Border Collie
Head Golder Retriever
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth Labrador
Nose Border Collie
Eyes Husky
Color Poodle