Liberty Lexus Crypto Game Dog - Mix of Boxer, Beagle, Poodle, Pitbull terrier, Golder Retriever, Border Collie, Husky and Labrador

Achievements

None
Liberty Lexus
I run on the information superhighway and haven't been hit by a car yet. Chasing anything that will run is so much fun, I could do that all day. I've been known to run with bad dogs. I don't like having to stay off the furniture. I'm not looking to hook up forever, just to have a little fun.
  • Purity 8%
  • Age 33 days
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACCTATCCAGATACACAAACAACCTACCAAAC
G
A
C
C
T
A
T
C
C
A
G
A
T
A
C
A
C
A
A
A
C
A
A
C
C
T
A
C
C
A
A
A
C
Genes: IDN8J4GGD5G

Composition

Boxer
27%
Beagle
18%
Poodle
9%
Pitbull terrier
9%
Golder Retriever
9%
Border Collie
9%
Husky
9%
Labrador
9%

Current Energy

Vitality +30 points
Lunar Effect -8 points

Traits Breakdown

Body Poodle
Tail Beagle
Legs Pitbull terrier
Front Legs Golder Retriever
Head Border Collie
Ears Husky
Snout Boxer
Mouth Boxer
Nose Beagle
Eyes Labrador
Color Boxer

Parents

No Children