Nickers Ned Crypto Dog - Mix of Boxer, Border Collie, Rottweiler, Poodle, Yorkshire Terrier, Maltese, Beagle, Corgi and German Shepard

Achievements

None
Nickers Ned
My name is Nickers Ned and I do tricks. I live behind a firewall in the Machine. I need laid otherwise I'm going to start agreeing with Grumpy Cat. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • Boxer 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACCACGACAACTACTTAACCCTATACAGCTCA
A
A
C
C
A
C
G
A
C
A
A
C
T
A
C
T
T
A
A
C
C
C
T
A
T
A
C
A
G
C
T
C
A
Genes: GHIGJFKDJO7

Composition

Boxer
18%
Border Collie
18%
Rottweiler
9%
Poodle
9%
Yorkshire Terrier
9%
Maltese
9%
Beagle
9%
Corgi
9%
German Shepard
9%

Current Energy

Vitality +19 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Rottweiler
Legs Poodle
Front Legs Boxer
Head Border Collie
Ears Yorkshire Terrier
Snout Maltese
Mouth Beagle
Nose Border Collie
Eyes Corgi
Color German Shepard

Parents

No Children