Master Chief Mcgruff Crypto Dog - Mix of German Shepard, Pitbull terrier, Border Collie, Beagle, Pug, Boxer and French Bulldog

Achievements

None
Master Chief Mcgruff
My name is Master Chief Mcgruff and I do tricks. I live behind a firewall in the Machine. I need laid otherwise I'm going to start agreeing with Grumpy Cat. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 14%
  • Age 3 months
  • Racing Exp 0
  • German Shepard 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATACTCATCACTAGAAAACTCACGATCCTCC
T
C
A
T
A
C
T
C
A
T
C
A
C
T
A
G
A
A
A
A
C
T
C
A
C
G
A
T
C
C
T
C
C
Genes: 7J77D2G79NN

Composition

German Shepard
36%
Pitbull terrier
18%
Border Collie
9%
Beagle
9%
Pug
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality -9 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Border Collie
Legs German Shepard
Front Legs German Shepard
Head Beagle
Ears Pug
Snout Boxer
Mouth German Shepard
Nose French Bulldog
Eyes Pitbull terrier
Color Pitbull terrier