Jester Judge Digital Cryptocurrency Game Dog - Mix of Maltese, Beagle, Golder Retriever, Pitbull terrier, Corgi, Boxer, Labrador, Rottweiler, St. Bernard, Husky and French Bulldog

Achievements

None
Jester Judge
I answer to 'Jester Judge'. I'm not a bad dog, my data is just configured that way. Too much steak gives me the runs! I hate having to wear foo-foo clothes and ribbons in my fur. My human's feet are definitely the greatest smell ever. Especially after a long day at work!
  • Purity 0%
  • Age 3 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCCTAAGATCCAGCAACCCACACTGAACACGA
A
C
C
C
T
A
A
G
A
T
C
C
A
G
C
A
A
C
C
C
A
C
A
C
T
G
A
A
C
A
C
G
A
Genes: KD8NOG5HB49

Composition

Maltese
9%
Beagle
9%
Golder Retriever
9%
Pitbull terrier
9%
Corgi
9%
Boxer
9%
Labrador
9%
Rottweiler
9%
St. Bernard
9%
Husky
9%
French Bulldog
9%

Current Energy

Vitality -36 points
Lunar Effect +4 points

Traits Breakdown

Body Maltese
Tail Beagle
Legs Golder Retriever
Front Legs Pitbull terrier
Head Corgi
Ears Boxer
Snout Labrador
Mouth Rottweiler
Nose St. Bernard
Eyes Husky
Color French Bulldog