Ashes Anakin Digital Cryptocurrency Game Dog - Mix of Labrador BK, Grey Wolf, German Shepard, Shiba Inu, French Bulldog, Corgi, Dachshund and Maltese

Achievements

None
Ashes Anakin
I answer to 'Ashes Anakin'. I'm not a bad dog, my data is just configured that way. Too much steak gives me the runs! I hate having to wear foo-foo clothes and ribbons in my fur. My human's feet are definitely the greatest smell ever. Especially after a long day at work!
  • Purity 9%
  • Age 33 days
  • Racing Exp 0
  • Labrador BK 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAGCAGTACCCCCCCGAGCAGCAAGCGGAACC
T
C
A
G
C
A
G
T
A
C
C
C
C
C
C
C
G
A
G
C
A
G
C
A
A
G
C
G
G
A
A
C
C
Genes: 76ELL966OAK

Composition

Labrador BK
27%
Grey Wolf
18%
German Shepard
9%
Shiba Inu
9%
French Bulldog
9%
Corgi
9%
Dachshund
9%
Maltese
9%

Current Energy

Vitality +33 points
Lunar Effect -10 points

Traits Breakdown

Body German Shepard
Tail Labrador BK
Legs Shiba Inu
Front Legs Grey Wolf
Head Grey Wolf
Ears French Bulldog
Snout Labrador BK
Mouth Labrador BK
Nose Corgi
Eyes Dachshund
Color Maltese