Accord Aiden Crypto Dog - Mix of Border Collie, Schnauzer, Yorkshire Terrier, Pitbull terrier, Boxer, Beagle, French Bulldog and Husky

Achievements

None
Accord Aiden
Well hello, beautiful. My name's Accord Aiden. I like to respond to sad puppy eyes with sad puppy eyes of my own. I don't understand why I like smelling butts... I don't appreciate being around bores who bark too much. If you are looking for companionship without commitment, so am I.
  • Purity 8%
  • Age 33 days
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTCCAACCTAATATTATTACGAACAATATAC
T
A
C
T
C
C
A
A
C
C
T
A
A
T
A
T
T
A
T
T
A
C
G
A
A
C
A
A
T
A
T
A
C
Genes: JNGDCFF94CJ

Composition

Border Collie
18%
Schnauzer
18%
Yorkshire Terrier
18%
Pitbull terrier
9%
Boxer
9%
Beagle
9%
French Bulldog
9%
Husky
9%

Current Energy

Vitality +4 points
Lunar Effect +2 points

Traits Breakdown

Body Border Collie
Tail Pitbull terrier
Legs Boxer
Front Legs Beagle
Head Schnauzer
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth French Bulldog
Nose Husky
Eyes Schnauzer
Color Border Collie

Parents

No Children