Quixote Queenie Crypto Dog - Mix of Dachshund, Pug, Maltese, Pitbull terrier, Labrador BK, German Shepard and Border Collie

Achievements

None
Quixote Queenie
Well hello, beautiful. My name's Quixote Queenie. I like to respond to sad puppy eyes with sad puppy eyes of my own. I don't understand why I like smelling butts... I don't appreciate being around bores who bark too much. If you are looking for companionship without commitment, so am I.
  • Purity 10%
  • Age 3 months
  • Racing Exp 0
  • Dachshund 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCGGAGAATCCGGAGCATCAGGATACGAAGGA
A
C
C
G
G
A
G
A
A
T
C
C
G
G
A
G
C
A
T
C
A
G
G
A
T
A
C
G
A
A
G
G
A
Genes: KA2NA67AJ2A

Composition

Dachshund
36%
Pug
18%
Maltese
9%
Pitbull terrier
9%
Labrador BK
9%
German Shepard
9%
Border Collie
9%

Current Energy

Vitality -59 points
Lunar Effect -4 points

Traits Breakdown

Body Maltese
Tail Dachshund
Legs Pug
Front Legs Pitbull terrier
Head Dachshund
Ears Labrador BK
Snout German Shepard
Mouth Dachshund
Nose Border Collie
Eyes Pug
Color Dachshund