Cassie Cotton Cryptocurrency Game Dog - Mix of Corgi, Shiba Inu, Poodle, Labrador, Border Collie, Rottweiler, Pitbull terrier, Maltese, Boxer and Husky

Achievements

None
Cassie Cotton
Hullo. My name is Cassie Cotton. I enjoy mixing it up once in a while by visiting different dog parks. I could spend days on end chasing my tail. I get so close but it's just so fast! I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).
  • Purity 1%
  • Age 33 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAGACCCATACCACTCCAGCACCAACACAAGC
G
T
A
G
A
C
C
C
A
T
A
C
C
A
C
T
C
C
A
G
C
A
C
C
A
A
C
A
C
A
A
G
C
Genes: EI5JHNOKG4O

Composition

Corgi
18%
Shiba Inu
9%
Poodle
9%
Labrador
9%
Border Collie
9%
Rottweiler
9%
Pitbull terrier
9%
Maltese
9%
Boxer
9%
Husky
9%

Current Energy

Vitality +43 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Poodle
Legs Labrador
Front Legs Border Collie
Head Rottweiler
Ears Pitbull terrier
Snout Corgi
Mouth Maltese
Nose Boxer
Eyes Husky
Color Corgi

Parents

No Children