Blackie Brady Cryptocurrency Game Dog - Mix of Grey Wolf, Husky, Pitbull terrier, French Bulldog, Maltese, Labrador, Beagle, Boxer, Poodle and Border Collie

Achievements

None
Blackie Brady
Hullo. My name is Blackie Brady. I enjoy mixing it up once in a while by visiting different dog parks. I could spend days on end chasing my tail. I get so close but it's just so fast! I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATCCCGACCCACCCCCCCACTAAACGACTAC
A
C
A
T
C
C
C
G
A
C
C
C
A
C
C
C
C
C
C
C
A
C
T
A
A
A
C
G
A
C
T
A
C
Genes: 4N9LKL5DGIJ

Composition

Grey Wolf
18%
Husky
9%
Pitbull terrier
9%
French Bulldog
9%
Maltese
9%
Labrador
9%
Beagle
9%
Boxer
9%
Poodle
9%
Border Collie
9%

Current Energy

Vitality -31 points
Lunar Effect -10 points

Traits Breakdown

Body Husky
Tail Pitbull terrier
Legs French Bulldog
Front Legs Grey Wolf
Head Maltese
Ears Grey Wolf
Snout Labrador
Mouth Beagle
Nose Boxer
Eyes Poodle
Color Border Collie