Chaucer Chopper Litecoin Game Dog - Mix of Corgi, German Shepard, Yorkshire Terrier, Golder Retriever, Husky, Pitbull terrier, French Bulldog, Dachshund, St. Bernard and Rottweiler

Achievements

None
Chaucer Chopper
Sup? ;-) I'm Chaucer Chopper. Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. I like it when you're frisky. I don't like having to stay off the furniture. I want someone who can show me a good time; I'll do the same for you.
  • Purity 3%
  • Age 33 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCATTAAGAACATCCCGAGGATGACACAGCAGC
T
C
A
T
T
A
A
G
A
A
C
A
T
C
C
C
G
A
G
G
A
T
G
A
C
A
C
A
G
C
A
G
C
Genes: 7F84N9ABHOO

Composition

Corgi
18%
German Shepard
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Husky
9%
Pitbull terrier
9%
French Bulldog
9%
Dachshund
9%
St. Bernard
9%
Rottweiler
9%

Current Energy

Vitality +31 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail Yorkshire Terrier
Legs Golder Retriever
Front Legs Husky
Head Pitbull terrier
Ears French Bulldog
Snout Dachshund
Mouth St. Bernard
Nose Rottweiler
Eyes Corgi
Color Corgi

Parents

No Children