Wilber Waldo Litecoin Game Dog - Mix of Boxer, Schnauzer, Beagle, Corgi, French Bulldog and Shiba Inu

Achievements

None
Wilber Waldo
Sup? ;-) I'm Wilber Waldo. Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. I like it when you're frisky. I don't like having to stay off the furniture. I want someone who can show me a good time; I'll do the same for you.
  • Purity 12%
  • Age 3 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCTAATAAGCAACCGAAACCTAATAATAGTA
A
A
C
C
T
A
A
T
A
A
G
C
A
A
C
C
G
A
A
A
C
C
T
A
A
T
A
A
T
A
G
T
A
Genes: GDCOG9GDCCE

Composition

Boxer
27%
Schnauzer
27%
Beagle
18%
Corgi
9%
French Bulldog
9%
Shiba Inu
9%

Current Energy

Vitality -50 points
Lunar Effect +8 points

Traits Breakdown

Body Boxer
Tail Beagle
Legs Schnauzer
Front Legs Corgi
Head Boxer
Ears French Bulldog
Snout Boxer
Mouth Beagle
Nose Schnauzer
Eyes Schnauzer
Color Shiba Inu