Scottie Spunky Digital Cryptocurrency Dog - Mix of Schnauzer, St. Bernard, Golder Retriever, Corgi, Grey Wolf, Labrador BK, German Shepard, Shiba Inu, Dachshund and Border Collie

Achievements

None
Scottie Spunky
I run exclusively on code. I am not above stealing food off humans' plates. Don't bother contacting me if you like cats. Air Bud is definitely my favorite movie. What a role model! I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite!
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Schnauzer 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAATAATAAGAAGCCCCGCATCAGTAGGATAC
T
G
A
A
T
A
A
T
A
A
G
A
A
G
C
C
C
C
G
C
A
T
C
A
G
T
A
G
G
A
T
A
C
Genes: BCC8OL67EAJ

Composition

Schnauzer
18%
St. Bernard
9%
Golder Retriever
9%
Corgi
9%
Grey Wolf
9%
Labrador BK
9%
German Shepard
9%
Shiba Inu
9%
Dachshund
9%
Border Collie
9%

Current Energy

Vitality -49 points
Lunar Effect +6 points

Traits Breakdown

Body St. Bernard
Tail Schnauzer
Legs Schnauzer
Front Legs Golder Retriever
Head Corgi
Ears Grey Wolf
Snout Labrador BK
Mouth German Shepard
Nose Shiba Inu
Eyes Dachshund
Color Border Collie