Junk Jerry Digital Cryptocurrency Dog - Mix of Yorkshire Terrier, Schnauzer, Poodle, Boxer, German Shepard, Golder Retriever and French Bulldog

Achievements

None
Junk Jerry
I run exclusively on code. I am not above stealing food off humans' plates. Don't bother contacting me if you like cats. Air Bud is definitely my favorite movie. What a role model! I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite!
  • Purity 9%
  • Age 31 days
  • Racing Exp 0
  • Yorkshire Terrier 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACTCAATAGACTTAAGAGACATATTATTACGA
A
A
C
T
C
A
A
T
A
G
A
C
T
T
A
A
G
A
G
A
C
A
T
A
T
T
A
T
T
A
C
G
A
Genes: G7CIF8ICFF9

Composition

Yorkshire Terrier
27%
Schnauzer
18%
Poodle
18%
Boxer
9%
German Shepard
9%
Golder Retriever
9%
French Bulldog
9%

Current Energy

Vitality -1 points
Lunar Effect -6 points

Traits Breakdown

Body Boxer
Tail German Shepard
Legs Schnauzer
Front Legs Poodle
Head Yorkshire Terrier
Ears Golder Retriever
Snout Poodle
Mouth Schnauzer
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color French Bulldog

Parents

No Children