Daxter Dare Litecoin Dog - Mix of Pitbull terrier, Boxer, Labrador, Border Collie, St. Bernard, Golder Retriever, Schnauzer, French Bulldog, Beagle and Poodle

Achievements

None
Daxter Dare
Hello there, my name is Daxter Dare. My favorite song is "Who Let the Dogs Out?" It was me :) They say my bite is worse than my bark. Halloween costumes are the worst, I hate 'em! As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Pitbull terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCCATACTGATCCAGAATACGATCCCTAGAC
A
A
C
C
C
A
T
A
C
T
G
A
T
C
C
A
G
A
A
T
A
C
G
A
T
C
C
C
T
A
G
A
C
Genes: G5JBN8C9NDI

Composition

Pitbull terrier
18%
Boxer
9%
Labrador
9%
Border Collie
9%
St. Bernard
9%
Golder Retriever
9%
Schnauzer
9%
French Bulldog
9%
Beagle
9%
Poodle
9%

Current Energy

Vitality -24 points
Lunar Effect +4 points

Traits Breakdown

Body Boxer
Tail Labrador
Legs Border Collie
Front Legs St. Bernard
Head Pitbull terrier
Ears Golder Retriever
Snout Schnauzer
Mouth French Bulldog
Nose Pitbull terrier
Eyes Beagle
Color Poodle