Louis Lexi Litecoin Dog - Mix of St. Bernard, Shiba Inu, Labrador, Labrador BK, Pitbull terrier, German Shepard, Schnauzer, Beagle, Husky and Border Collie

Achievements

None
Louis Lexi
Hello there, my name is Louis Lexi. My favorite song is "Who Let the Dogs Out?" It was me :) They say my bite is worse than my bark. Halloween costumes are the worst, I hate 'em! As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 1%
  • Age 33 days
  • Racing Exp 0
  • St. Bernard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATGACCAGCATCCTCAATACTATGAACATAC
G
T
A
T
G
A
C
C
A
G
C
A
T
C
C
T
C
A
A
T
A
C
T
A
T
G
A
A
C
A
T
A
C
Genes: EB56N7CDB4J

Composition

St. Bernard
18%
Shiba Inu
9%
Labrador
9%
Labrador BK
9%
Pitbull terrier
9%
German Shepard
9%
Schnauzer
9%
Beagle
9%
Husky
9%
Border Collie
9%

Current Energy

Vitality +30 points
Lunar Effect +10 points

Traits Breakdown

Body Shiba Inu
Tail St. Bernard
Legs Labrador
Front Legs Labrador BK
Head Pitbull terrier
Ears German Shepard
Snout Schnauzer
Mouth Beagle
Nose St. Bernard
Eyes Husky
Color Border Collie