Natasha Nick Litecoin Dog - Mix of Yorkshire Terrier, Poodle, Shiba Inu, Schnauzer, St. Bernard, Labrador BK, Husky and Pug

Achievements

None
Natasha Nick
Are you into garbage cans? I am. Too much steak gives me the runs! My favorite pastime is playing tug-of-war with my human's underwear. I don't like having to stay in the car when my people go inside. If you are looking for a pooch who's in touch with feelings, here I am.
  • Purity 4%
  • Age 3 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTAGACATATGATTAGCAACAGTAGAAGTAGAC
T
T
A
G
A
C
A
T
A
T
G
A
T
T
A
G
C
A
A
C
A
G
T
A
G
A
A
G
T
A
G
A
C
Genes: FICBF64E2EI

Composition

Yorkshire Terrier
18%
Poodle
18%
Shiba Inu
18%
Schnauzer
9%
St. Bernard
9%
Labrador BK
9%
Husky
9%
Pug
9%

Current Energy

Vitality -39 points
Lunar Effect +6 points

Traits Breakdown

Body Yorkshire Terrier
Tail Poodle
Legs Schnauzer
Front Legs St. Bernard
Head Yorkshire Terrier
Ears Labrador BK
Snout Husky
Mouth Shiba Inu
Nose Pug
Eyes Shiba Inu
Color Poodle