Mouse Muffin Litecoin Dog - Mix of Shiba Inu, Husky, Maltese, Corgi, German Shepard, Labrador BK, Grey Wolf, Beagle and Dachshund

Achievements

None
Mouse Muffin
Are you into garbage cans? I am. Too much steak gives me the runs! My favorite pastime is playing tug-of-war with my human's underwear. I don't like having to stay in the car when my people go inside. If you are looking for a pooch who's in touch with feelings, here I am.
  • Purity 5%
  • Age 33 days
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAGTAACCAGCTCAGCACCCACACTAACAGGA
G
T
A
G
T
A
A
C
C
A
G
C
T
C
A
G
C
A
C
C
C
A
C
A
C
T
A
A
C
A
G
G
A
Genes: EEKO76L4D4A

Composition

Shiba Inu
18%
Husky
18%
Maltese
9%
Corgi
9%
German Shepard
9%
Labrador BK
9%
Grey Wolf
9%
Beagle
9%
Dachshund
9%

Current Energy

Vitality +10 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Maltese
Front Legs Corgi
Head German Shepard
Ears Labrador BK
Snout Grey Wolf
Mouth Husky
Nose Beagle
Eyes Husky
Color Dachshund

Parents

No Children