Evy Emmett Cryptocurrency Game Dog - Mix of Pitbull terrier, Beagle, Maltese, Golder Retriever, Labrador BK, French Bulldog, Labrador and Pug

Achievements

None
Evy Emmett
I'm Evy Emmett. How goes it? Size matters. This dawg's into big databases. My female human wears crotchless undies, but she doesn't like the ones I make for her! Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers.
  • Purity 6%
  • Age 33 days
  • Racing Exp 0
  • Pitbull terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCAGACTATCCACCACCGCACGACCACTAGAA
T
C
C
A
G
A
C
T
A
T
C
C
A
C
C
A
C
C
G
C
A
C
G
A
C
C
A
C
T
A
G
A
A
Genes: N8DNKK695D2

Composition

Pitbull terrier
18%
Beagle
18%
Maltese
18%
Golder Retriever
9%
Labrador BK
9%
French Bulldog
9%
Labrador
9%
Pug
9%

Current Energy

Vitality -2 points
Lunar Effect -2 points

Traits Breakdown

Body Pitbull terrier
Tail Golder Retriever
Legs Beagle
Front Legs Pitbull terrier
Head Maltese
Ears Maltese
Snout Labrador BK
Mouth French Bulldog
Nose Labrador
Eyes Beagle
Color Pug

Parents

No Children