Laser Longo Doggo Cryptocurrency Game Dog - Mix of Pitbull terrier, Border Collie, Shiba Inu, St. Bernard, Boxer, Golder Retriever, Maltese, Dachshund, Rottweiler and French Bulldog

Achievements

None
Laser Longo Doggo
I'm Laser Longo Doggo. How goes it? Size matters. This dawg's into big databases. My female human wears crotchless undies, but she doesn't like the ones I make for her! Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays.
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Pitbull terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGTATGAAACAGAACCGGATCCTCCCACCGA
T
A
C
G
T
A
T
G
A
A
A
C
A
G
A
A
C
C
G
G
A
T
C
C
T
C
C
C
A
C
C
G
A
Genes: JEBG8KANNH9

Composition

Pitbull terrier
18%
Border Collie
9%
Shiba Inu
9%
St. Bernard
9%
Boxer
9%
Golder Retriever
9%
Maltese
9%
Dachshund
9%
Rottweiler
9%
French Bulldog
9%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Shiba Inu
Legs St. Bernard
Front Legs Boxer
Head Golder Retriever
Ears Maltese
Snout Dachshund
Mouth Pitbull terrier
Nose Pitbull terrier
Eyes Rottweiler
Color French Bulldog