Uhura Ursa Litecoin Game Dog - Mix of Beagle, Golder Retriever, Grey Wolf, Labrador, Maltese, Poodle and Husky

Achievements

None
Uhura Ursa
I've been known to take mega bytes when playing ruff. My bark alone scares birds out of my yard. If I can't reach it to clean it myself, it doesn't need cleaning! Peanut butter is delish but I HATE when it sticks to the roof of my mouth. In my humble opinion the best toy is one of my human's stinky, old socks.
  • Purity 11%
  • Age 34 days
  • Racing Exp 0
  • Beagle 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGACCAACCCCCCCCCTACTAAGAGACCTAACA
A
G
A
C
C
A
A
C
C
C
C
C
C
C
C
C
T
A
C
T
A
A
G
A
G
A
C
C
T
A
A
C
A
Genes: 85KLLDD8ID4

Composition

Beagle
27%
Golder Retriever
18%
Grey Wolf
18%
Labrador
9%
Maltese
9%
Poodle
9%
Husky
9%

Current Energy

Vitality +24 points
Lunar Effect -12 points

Traits Breakdown

Body Golder Retriever
Tail Labrador
Legs Maltese
Front Legs Grey Wolf
Head Grey Wolf
Ears Beagle
Snout Beagle
Mouth Golder Retriever
Nose Poodle
Eyes Beagle
Color Husky

Parents

No Children