Gypsy Gretel Litecoin Game Dog - Mix of Labrador, Pitbull terrier, Labrador BK, St. Bernard, Pug, Grey Wolf, Border Collie, Shiba Inu, Corgi and Schnauzer

Achievements

None
Gypsy Gretel
I've been known to take mega bytes when playing ruff. My bark alone scares birds out of my yard. If I can't reach it to clean it myself, it doesn't need cleaning! Peanut butter is delish but I HATE when it sticks to the roof of my mouth. In my humble opinion the best toy is one of my human's stinky, old socks.
  • Purity 1%
  • Age 4 months
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCCCAGCATGAGAACCCTACGTAAGCATACCA
T
C
C
C
C
A
G
C
A
T
G
A
G
A
A
C
C
C
T
A
C
G
T
A
A
G
C
A
T
A
C
C
A
Genes: N56B2LJEOC5

Composition

Labrador
18%
Pitbull terrier
9%
Labrador BK
9%
St. Bernard
9%
Pug
9%
Grey Wolf
9%
Border Collie
9%
Shiba Inu
9%
Corgi
9%
Schnauzer
9%

Current Energy

Vitality -36 points
Lunar Effect +4 points

Traits Breakdown

Body Pitbull terrier
Tail Labrador
Legs Labrador BK
Front Legs St. Bernard
Head Pug
Ears Grey Wolf
Snout Border Collie
Mouth Shiba Inu
Nose Corgi
Eyes Schnauzer
Color Labrador