Moe Moses Crypto Game Dog - Mix of Beagle, German Shepard, Pug, Rottweiler, Boxer, Labrador, Corgi, Yorkshire Terrier, Schnauzer and French Bulldog

Achievements

None
Moe Moses
How do you do? I'm Moe Moses. I am a guard dog for the data warehouse. Size doesn't matter, I like 'em all. I don't understand why I like smelling butts... Peanut butter is delish but I HATE when it sticks to the roof of my mouth. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide!
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATCAGAACACAACCCAAGCTTAATACGACTA
C
T
A
T
C
A
G
A
A
C
A
C
A
A
C
C
C
A
A
G
C
T
T
A
A
T
A
C
G
A
C
T
A
Genes: D72HG5OFC9D

Composition

Beagle
18%
German Shepard
9%
Pug
9%
Rottweiler
9%
Boxer
9%
Labrador
9%
Corgi
9%
Yorkshire Terrier
9%
Schnauzer
9%
French Bulldog
9%

Current Energy

Vitality -49 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail German Shepard
Legs Pug
Front Legs Rottweiler
Head Boxer
Ears Labrador
Snout Corgi
Mouth Yorkshire Terrier
Nose Schnauzer
Eyes French Bulldog
Color Beagle