Emma Emmitt Crypto Game Dog - Mix of Labrador, Poodle, Rottweiler, Golder Retriever, Beagle, Yorkshire Terrier, Boxer, Pitbull terrier and Border Collie

Achievements

None
Emma Emmitt
How do you do? I'm Emma Emmitt. I am a guard dog for the data warehouse. Size doesn't matter, I like 'em all. I don't understand why I like smelling butts... Peanut butter is delish but I HATE when it sticks to the roof of my mouth. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide!
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACCCAGACAGACTACCATTAAACTCCGACTAC
C
A
C
C
C
A
G
A
C
A
G
A
C
T
A
C
C
A
T
T
A
A
A
C
T
C
C
G
A
C
T
A
C
Genes: H5I8D5FGNIJ

Composition

Labrador
18%
Poodle
18%
Rottweiler
9%
Golder Retriever
9%
Beagle
9%
Yorkshire Terrier
9%
Boxer
9%
Pitbull terrier
9%
Border Collie
9%

Current Energy

Vitality +17 points
Lunar Effect +2 points

Traits Breakdown

Body Rottweiler
Tail Labrador
Legs Poodle
Front Legs Golder Retriever
Head Beagle
Ears Labrador
Snout Yorkshire Terrier
Mouth Boxer
Nose Pitbull terrier
Eyes Poodle
Color Border Collie

Parents

No Children