Dynamite Dracula Bitcoin Dog - Mix of Labrador, Pug, Grey Wolf, Yorkshire Terrier, Dachshund, Golder Retriever, French Bulldog, Beagle, Schnauzer and Labrador BK

Achievements

None
Dynamite Dracula
I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! If I can't reach it to clean it myself, it doesn't need cleaning! If you are looking for companionship without commitment, so am I.
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAGAACCCTTAGGAAGACGACCACTAATAGCA
C
C
A
G
A
A
C
C
C
T
T
A
G
G
A
A
G
A
C
G
A
C
C
A
C
T
A
A
T
A
G
C
A
Genes: 52LFA895DC6

Composition

Labrador
18%
Pug
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Dachshund
9%
Golder Retriever
9%
French Bulldog
9%
Beagle
9%
Schnauzer
9%
Labrador BK
9%

Current Energy

Vitality -23 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Pug
Legs Grey Wolf
Front Legs Yorkshire Terrier
Head Dachshund
Ears Golder Retriever
Snout French Bulldog
Mouth Labrador
Nose Beagle
Eyes Schnauzer
Color Labrador BK