Champ Cocoa Bitcoin Dog - Mix of Rottweiler, Golder Retriever, Corgi, Dachshund, Maltese, Labrador, Pug and Border Collie

Achievements

None
Champ Cocoa
I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! If I can't reach it to clean it myself, it doesn't need cleaning! If you are looking for companionship without commitment, so am I.
  • Purity 4%
  • Age 31 days
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGACACAGAAGCACCCCAAGCGAACACTACAGA
G
G
A
C
A
C
A
G
A
A
G
C
A
C
C
C
C
A
A
G
C
G
A
A
C
A
C
T
A
C
A
G
A
Genes: AH8OK5O2HJ8

Composition

Rottweiler
18%
Golder Retriever
18%
Corgi
18%
Dachshund
9%
Maltese
9%
Labrador
9%
Pug
9%
Border Collie
9%

Current Energy

Vitality +19 points
Lunar Effect -4 points

Traits Breakdown

Body Dachshund
Tail Rottweiler
Legs Golder Retriever
Front Legs Corgi
Head Maltese
Ears Labrador
Snout Corgi
Mouth Pug
Nose Rottweiler
Eyes Border Collie
Color Golder Retriever

Parents

No Children