Kobe Killian Crypto Dog - Mix of Corgi, Maltese, Golder Retriever, Poodle, Schnauzer, Rottweiler, Boxer, Labrador BK, Pug and Labrador

Achievements

None
Kobe Killian
Hola! My name is Kobe Killian. I don't like having to stay off the furniture. I'll eat my vomit and yours too. My favorite song is "Who Let the Dogs Out?" It was me :) I like shaking my fur next to humans right after a good swim! I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 1%
  • Age 31 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCAGAAGCGACATACACAGCAACGCAGAACCA
A
C
C
A
G
A
A
G
C
G
A
C
A
T
A
C
A
C
A
G
C
A
A
C
G
C
A
G
A
A
C
C
A
Genes: K8OICHOG625

Composition

Corgi
18%
Maltese
9%
Golder Retriever
9%
Poodle
9%
Schnauzer
9%
Rottweiler
9%
Boxer
9%
Labrador BK
9%
Pug
9%
Labrador
9%

Current Energy

Vitality -1 points
Lunar Effect -10 points

Traits Breakdown

Body Maltese
Tail Golder Retriever
Legs Corgi
Front Legs Poodle
Head Schnauzer
Ears Rottweiler
Snout Corgi
Mouth Boxer
Nose Labrador BK
Eyes Pug
Color Labrador

Parents

No Children