Little-One Leather Crypto Dog - Mix of Golder Retriever, Pug, Poodle, Rottweiler, St. Bernard, Border Collie, Labrador BK, Beagle and Yorkshire Terrier

Achievements

None
Little-One Leather
Hola! My name is Little-One Leather. I don't like having to stay off the furniture. I'll eat my vomit and yours too. My favorite song is "Who Let the Dogs Out?" It was me :) I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 5%
  • Age 3 months
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACAGACACTGAAGATACGCACTATTAGAAGAA
G
A
C
A
G
A
C
A
C
T
G
A
A
G
A
T
A
C
G
C
A
C
T
A
T
T
A
G
A
A
G
A
A
Genes: I8HB8J6DF22

Composition

Golder Retriever
18%
Pug
18%
Poodle
9%
Rottweiler
9%
St. Bernard
9%
Border Collie
9%
Labrador BK
9%
Beagle
9%
Yorkshire Terrier
9%

Current Energy

Vitality -40 points
Lunar Effect 0 points

Traits Breakdown

Body Poodle
Tail Golder Retriever
Legs Rottweiler
Front Legs St. Bernard
Head Golder Retriever
Ears Border Collie
Snout Labrador BK
Mouth Beagle
Nose Yorkshire Terrier
Eyes Pug
Color Pug