Gaston Gringo Bitcoin Game Dog - Mix of Labrador BK, Beagle, Rottweiler, Corgi, Pitbull terrier, Border Collie, French Bulldog, Shiba Inu, Pug, Dachshund and Poodle

Achievements

None
Gaston Gringo
I don't understand why I like smelling butts... I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. My bark alone scares birds out of my yard. My favorite thing is to sit in my humans' laps while they are trying to read or drive.
  • Purity 0%
  • Age 3 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACTACACAGCTCCTACCGAGTAGAAGGAGAC
G
C
A
C
T
A
C
A
C
A
G
C
T
C
C
T
A
C
C
G
A
G
T
A
G
A
A
G
G
A
G
A
C
Genes: 6DHONJ9E2AI

Composition

Labrador BK
9%
Beagle
9%
Rottweiler
9%
Corgi
9%
Pitbull terrier
9%
Border Collie
9%
French Bulldog
9%
Shiba Inu
9%
Pug
9%
Dachshund
9%
Poodle
9%

Current Energy

Vitality -33 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Beagle
Legs Rottweiler
Front Legs Corgi
Head Pitbull terrier
Ears Border Collie
Snout French Bulldog
Mouth Shiba Inu
Nose Pug
Eyes Dachshund
Color Poodle