Mulan Mai Tai Bitcoin Game Dog - Mix of Labrador BK, Boxer, Maltese, Golder Retriever, Pug and German Shepard

Achievements

None
Mulan Mai Tai
I don't understand why I like smelling butts... I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. My bark alone scares birds out of my yard. My favorite thing is to sit in my humans' laps while they are trying to read or drive.
  • Purity 12%
  • Age 33 days
  • Racing Exp 0
  • Labrador BK 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAAAACGCATCAACCAACAGAAGAGCAGCAACC
G
A
A
A
A
C
G
C
A
T
C
A
A
C
C
A
A
C
A
G
A
A
G
A
G
C
A
G
C
A
A
C
C
Genes: 2G67KG8866K

Composition

Labrador BK
27%
Boxer
18%
Maltese
18%
Golder Retriever
18%
Pug
9%
German Shepard
9%

Current Energy

Vitality +18 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Boxer
Legs Labrador BK
Front Legs German Shepard
Head Maltese
Ears Boxer
Snout Golder Retriever
Mouth Golder Retriever
Nose Labrador BK
Eyes Labrador BK
Color Maltese