Olimar Ozzy Pawsborne Litecoin Dog - Mix of Labrador, Corgi, Husky, Grey Wolf, Yorkshire Terrier, Labrador BK, Golder Retriever, Dachshund and Boxer

Achievements

None
Olimar Ozzy Pawsborne
I'm Olimar Ozzy Pawsborne. What do they call you? I live inside of a Virtual machine two steps to the right from the firewall. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. They say my bite is worse than my bark. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents.
  • Purity 5%
  • Age 31 days
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAAGCACACCCTTAAGCGCAAGAGGAAACCCA
C
C
A
A
G
C
A
C
A
C
C
C
T
T
A
A
G
C
G
C
A
A
G
A
G
G
A
A
A
C
C
C
A
Genes: 5O4LFO68AG5

Composition

Labrador
18%
Corgi
18%
Husky
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Labrador BK
9%
Golder Retriever
9%
Dachshund
9%
Boxer
9%

Current Energy

Vitality +46 points
Lunar Effect -2 points

Traits Breakdown

Body Labrador
Tail Corgi
Legs Husky
Front Legs Grey Wolf
Head Yorkshire Terrier
Ears Corgi
Snout Labrador BK
Mouth Golder Retriever
Nose Dachshund
Eyes Boxer
Color Labrador

Parents

No Children