Yeller Yoda Litecoin Dog - Mix of German Shepard, Rottweiler, Pug, Corgi, St. Bernard, Grey Wolf, Maltese, Shiba Inu, Labrador, Beagle and Dachshund

Achievements

None
Yeller Yoda
I'm Yeller Yoda. What do they call you? I live inside of a Virtual machine two steps to the right from the firewall. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. They say my bite is worse than my bark. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents.
  • Purity 0%
  • Age 3 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACACGAAAGCTGACCCACCGTACCACTAGGA
T
C
A
C
A
C
G
A
A
A
G
C
T
G
A
C
C
C
A
C
C
G
T
A
C
C
A
C
T
A
G
G
A
Genes: 7H2OBLKE5DA

Composition

German Shepard
9%
Rottweiler
9%
Pug
9%
Corgi
9%
St. Bernard
9%
Grey Wolf
9%
Maltese
9%
Shiba Inu
9%
Labrador
9%
Beagle
9%
Dachshund
9%

Current Energy

Vitality -38 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Rottweiler
Legs Pug
Front Legs Corgi
Head St. Bernard
Ears Grey Wolf
Snout Maltese
Mouth Shiba Inu
Nose Labrador
Eyes Beagle
Color Dachshund