Scoobie Sawyer Crypto Dog - Mix of Border Collie, Grey Wolf, Shiba Inu, Beagle, Corgi, French Bulldog, German Shepard and Rottweiler

Achievements

None
Scoobie Sawyer
How YOU doin'? Scoobie Sawyer here. I'm always up for some puppy action, is that wrong? Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I am a proud show dog. I like showing off my perfect coat! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 6%
  • Age 3 months
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGTACTAAGCTACCGACCCTACTCACACCCC
T
A
C
G
T
A
C
T
A
A
G
C
T
A
C
C
G
A
C
C
C
T
A
C
T
C
A
C
A
C
C
C
C
Genes: JEDOJ9LJ7HL

Composition

Border Collie
27%
Grey Wolf
18%
Shiba Inu
9%
Beagle
9%
Corgi
9%
French Bulldog
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality -29 points
Lunar Effect -6 points

Traits Breakdown

Body Border Collie
Tail Shiba Inu
Legs Beagle
Front Legs Corgi
Head Border Collie
Ears French Bulldog
Snout Grey Wolf
Mouth Border Collie
Nose German Shepard
Eyes Rottweiler
Color Grey Wolf