Tinker Twiggy Crypto Dog - Mix of Rottweiler, Pitbull terrier, French Bulldog, Border Collie, Golder Retriever, Husky, German Shepard, Corgi and Labrador BK

Achievements

None
Tinker Twiggy
How YOU doin'? Tinker Twiggy here. I'm always up for some puppy action, is that wrong? Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I am a proud show dog. I like showing off my perfect coat! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 5%
  • Age 31 days
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGATACAGAACACACCACTCCTCAAGCGCATCC
C
G
A
T
A
C
A
G
A
A
C
A
C
A
C
C
A
C
T
C
C
T
C
A
A
G
C
G
C
A
T
C
C
Genes: 9J84HHN7O6N

Composition

Rottweiler
18%
Pitbull terrier
18%
French Bulldog
9%
Border Collie
9%
Golder Retriever
9%
Husky
9%
German Shepard
9%
Corgi
9%
Labrador BK
9%

Current Energy

Vitality +42 points
Lunar Effect +8 points

Traits Breakdown

Body French Bulldog
Tail Border Collie
Legs Golder Retriever
Front Legs Husky
Head Rottweiler
Ears Rottweiler
Snout Pitbull terrier
Mouth German Shepard
Nose Corgi
Eyes Labrador BK
Color Pitbull terrier

Parents

No Children