Ginger Ginny Cryptocurrency Game Dog - Mix of Pug, Border Collie, Labrador, Husky, Grey Wolf, St. Bernard, Pitbull terrier, Maltese and German Shepard

Achievements

None
Ginger Ginny
You'll find me walking into my favorite pet store like I own the place. I do, don't I? Size doesn't matter, I like 'em all. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I want to find a mate who enjoys dog parks as much as I do.
  • Purity 4%
  • Age 31 days
  • Racing Exp 0
  • Pug 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACGAACCAACACCCTGATCCACCGAATCAGAA
T
A
C
G
A
A
C
C
A
A
C
A
C
C
C
T
G
A
T
C
C
A
C
C
G
A
A
T
C
A
G
A
A
Genes: J254LBNK272

Composition

Pug
27%
Border Collie
9%
Labrador
9%
Husky
9%
Grey Wolf
9%
St. Bernard
9%
Pitbull terrier
9%
Maltese
9%
German Shepard
9%

Current Energy

Vitality +42 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Labrador
Front Legs Husky
Head Grey Wolf
Ears St. Bernard
Snout Pitbull terrier
Mouth Maltese
Nose Pug
Eyes German Shepard
Color Pug

Parents

No Children