Juliette Jasmine Cryptocurrency Game Dog - Mix of Border Collie, Corgi, Yorkshire Terrier, Boxer, Dachshund, Poodle, Beagle, French Bulldog, Labrador BK and Pug

Achievements

None
Juliette Jasmine
You'll find me walking into my favorite pet store like I own the place. I do, don't I? Size doesn't matter, I like 'em all. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I want to find a mate who enjoys dog parks as much as I do.
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCTACTTAAACGGAGACCTACGAGCAGAATAC
A
G
C
T
A
C
T
T
A
A
A
C
G
G
A
G
A
C
C
T
A
C
G
A
G
C
A
G
A
A
T
A
C
Genes: OJFGAID962J

Composition

Border Collie
18%
Corgi
9%
Yorkshire Terrier
9%
Boxer
9%
Dachshund
9%
Poodle
9%
Beagle
9%
French Bulldog
9%
Labrador BK
9%
Pug
9%

Current Energy

Vitality -36 points
Lunar Effect -4 points

Traits Breakdown

Body Corgi
Tail Border Collie
Legs Yorkshire Terrier
Front Legs Boxer
Head Dachshund
Ears Poodle
Snout Beagle
Mouth French Bulldog
Nose Labrador BK
Eyes Pug
Color Border Collie