Turbo Tani Bitcoin Dog - Mix of Corgi, Pug, Pitbull terrier, Schnauzer, Grey Wolf, French Bulldog, German Shepard, Dachshund and Labrador BK

Achievements

None
Turbo Tani
Turbo Tani here. Wanna play? Even living on the internet like I do, too much kibble makes my bandwidth expand. I have a crush on the Grumpy cat. I hate it when my humans fart and they blame me! I'm looking for a hard-working service animal who can keep up with me.
  • Purity 4%
  • Age 31 days
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAAAGCTCCATACCCCGAAGCTCAGGAGCAAGC
G
A
A
A
G
C
T
C
C
A
T
A
C
C
C
C
G
A
A
G
C
T
C
A
G
G
A
G
C
A
A
G
C
Genes: 2ONCL9O7A6O

Composition

Corgi
27%
Pug
9%
Pitbull terrier
9%
Schnauzer
9%
Grey Wolf
9%
French Bulldog
9%
German Shepard
9%
Dachshund
9%
Labrador BK
9%

Current Energy

Vitality -12 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Corgi
Legs Pitbull terrier
Front Legs Schnauzer
Head Grey Wolf
Ears French Bulldog
Snout Corgi
Mouth German Shepard
Nose Dachshund
Eyes Labrador BK
Color Corgi

Parents

No Children