Ryu Rufus Bitcoin Dog - Mix of Boxer, French Bulldog, Poodle, Dachshund, St. Bernard, Yorkshire Terrier, Grey Wolf, Maltese, Golder Retriever and Shiba Inu

Achievements

None
Ryu Rufus
Ryu Rufus here. Wanna play? Even living on the internet like I do, too much kibble makes my bandwidth expand. I have a crush on the Grumpy cat. I hate it when my humans fart and they blame me! I'm looking for a hard-working service animal who can keep up with me.
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Boxer 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCGAGACGGATGAAACTTACCCACCAGAGTA
A
A
C
C
G
A
G
A
C
G
G
A
T
G
A
A
A
C
T
T
A
C
C
C
A
C
C
A
G
A
G
T
A
Genes: G9IABGFLK8E

Composition

Boxer
18%
French Bulldog
9%
Poodle
9%
Dachshund
9%
St. Bernard
9%
Yorkshire Terrier
9%
Grey Wolf
9%
Maltese
9%
Golder Retriever
9%
Shiba Inu
9%

Current Energy

Vitality -31 points
Lunar Effect -8 points

Traits Breakdown

Body Boxer
Tail French Bulldog
Legs Poodle
Front Legs Dachshund
Head St. Bernard
Ears Boxer
Snout Yorkshire Terrier
Mouth Grey Wolf
Nose Maltese
Eyes Golder Retriever
Color Shiba Inu