Pirate Pebbles Litecoin Dog - Mix of Rottweiler, Yorkshire Terrier, Border Collie, Pitbull terrier, St. Bernard, Beagle, Shiba Inu, Boxer and Poodle

Achievements

None
Pirate Pebbles
Salutations! My name's Pirate Pebbles. Baby, I'm made from the same stuff as dreams. I have a crush on the Grumpy cat. I like nibbling on most everything, but I'll bite if you want me to. I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.
  • Purity 7%
  • Age 3 months
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTACTCCTGACTAGTAAACTTATTAGACCAC
C
A
C
T
A
C
T
C
C
T
G
A
C
T
A
G
T
A
A
A
C
T
T
A
T
T
A
G
A
C
C
A
C
Genes: HJNBDEGFFIH

Composition

Rottweiler
18%
Yorkshire Terrier
18%
Border Collie
9%
Pitbull terrier
9%
St. Bernard
9%
Beagle
9%
Shiba Inu
9%
Boxer
9%
Poodle
9%

Current Energy

Vitality -26 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Border Collie
Legs Pitbull terrier
Front Legs St. Bernard
Head Beagle
Ears Shiba Inu
Snout Boxer
Mouth Yorkshire Terrier
Nose Yorkshire Terrier
Eyes Poodle
Color Rottweiler