Ned Nosey Litecoin Dog - Mix of Labrador BK, Labrador, German Shepard, French Bulldog, Dachshund, Maltese, Shiba Inu, Grey Wolf, Schnauzer and Golder Retriever

Achievements

None
Ned Nosey
Salutations! My name's Ned Nosey. Baby, I'm made from the same stuff as dreams. I have a crush on the Grumpy cat. I like nibbling on most everything, but I'll bite if you want me to. I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.
  • Purity 1%
  • Age 31 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCATCACGAGGAGCAACCGTACCCATAAGAGCA
C
C
A
T
C
A
C
G
A
G
G
A
G
C
A
A
C
C
G
T
A
C
C
C
A
T
A
A
G
A
G
C
A
Genes: 579A6KELC86

Composition

Labrador BK
18%
Labrador
9%
German Shepard
9%
French Bulldog
9%
Dachshund
9%
Maltese
9%
Shiba Inu
9%
Grey Wolf
9%
Schnauzer
9%
Golder Retriever
9%

Current Energy

Vitality +16 points
Lunar Effect +8 points

Traits Breakdown

Body Labrador
Tail German Shepard
Legs French Bulldog
Front Legs Dachshund
Head Labrador BK
Ears Maltese
Snout Shiba Inu
Mouth Grey Wolf
Nose Schnauzer
Eyes Golder Retriever
Color Labrador BK

Parents

No Children