Pongo Pong Crypto Dog - Mix of Golder Retriever, St. Bernard, Labrador, Beagle, Labrador BK, Poodle, Dachshund and Shiba Inu

Achievements

None
Pongo Pong
When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I'm not into dog collars, unless you're into S & M. I've been looking for love in all the wrong places... As a perfectionist, I have to find just the right 'spot'. I'm looking for some ruff play. Wanna bite me?
  • Purity 4%
  • Age 15 months
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAAGAGCAGACGGATGACCATGAAGACCAGTA
C
T
A
A
G
A
G
C
A
G
A
C
G
G
A
T
G
A
C
C
A
T
G
A
A
G
A
C
C
A
G
T
A
Genes: D86IAB5B85E

Composition

Golder Retriever
18%
St. Bernard
18%
Labrador
18%
Beagle
9%
Labrador BK
9%
Poodle
9%
Dachshund
9%
Shiba Inu
9%

Current Energy

Vitality -38 points
Lunar Effect +6 points

Traits Breakdown

Body Beagle
Tail Golder Retriever
Legs Labrador BK
Front Legs Poodle
Head Dachshund
Ears St. Bernard
Snout Labrador
Mouth St. Bernard
Nose Golder Retriever
Eyes Labrador
Color Shiba Inu