Sable Scout Crypto Dog - Mix of Labrador BK, Border Collie, Beagle, Grey Wolf, Pug, Rottweiler, St. Bernard, Dachshund and Yorkshire Terrier

Achievements

None
Sable Scout
When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I'm not into dog collars, unless you're into S & M. I've been looking for love in all the wrong places... As a perfectionist, I have to find just the right 'spot'. I'm looking for some ruff play. Wanna bite me?
  • Purity 5%
  • Age 31 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTACCCGAAGCACACTGATACTACGCAGGATTA
C
T
A
C
C
C
G
A
A
G
C
A
C
A
C
T
G
A
T
A
C
T
A
C
G
C
A
G
G
A
T
T
A
Genes: DL26HBJJ6AF

Composition

Labrador BK
18%
Border Collie
18%
Beagle
9%
Grey Wolf
9%
Pug
9%
Rottweiler
9%
St. Bernard
9%
Dachshund
9%
Yorkshire Terrier
9%

Current Energy

Vitality +13 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Grey Wolf
Legs Pug
Front Legs Labrador BK
Head Rottweiler
Ears St. Bernard
Snout Border Collie
Mouth Border Collie
Nose Labrador BK
Eyes Dachshund
Color Yorkshire Terrier

Parents

No Children