Luna Libby Crypto Dog - Mix of French Bulldog, Schnauzer, Pug, Dachshund, Maltese, Husky and Labrador BK

Achievements

None
Luna Libby
How do you do? I'm Luna Libby. Those flying monkeys in the Wizard of Oz still scare me! I'm not into dog collars, unless you're into S & M. My favorite way to relax is to be scratched on my belly. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 6%
  • Age 33 days
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGAATAACCATAACAGAAGGAGAAGCACGAGGA
C
G
A
A
T
A
A
C
C
A
T
A
A
C
A
G
A
A
G
G
A
G
A
A
G
C
A
C
G
A
G
G
A
Genes: 9CKC42A269A

Composition

French Bulldog
18%
Schnauzer
18%
Pug
18%
Dachshund
18%
Maltese
9%
Husky
9%
Labrador BK
9%

Current Energy

Vitality +1 points
Lunar Effect -2 points

Traits Breakdown

Body French Bulldog
Tail Schnauzer
Legs Maltese
Front Legs Schnauzer
Head Husky
Ears Pug
Snout Dachshund
Mouth Pug
Nose Labrador BK
Eyes French Bulldog
Color Dachshund

Parents

No Children