Timmy Toby Crypto Dog - Mix of Labrador BK, Pug, Corgi, Border Collie, Shiba Inu, German Shepard, Beagle and Boxer

Achievements

None
Timmy Toby
How do you do? I'm Timmy Toby. Those flying monkeys in the Wizard of Oz still scare me! I'm not into dog collars, unless you're into S & M. My favorite way to relax is to be scratched on my belly. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 6%
  • Age 3 months
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATACGAAGTAGCAGAAAGCAGCTCACTAAAC
G
C
A
T
A
C
G
A
A
G
T
A
G
C
A
G
A
A
A
G
C
A
G
C
T
C
A
C
T
A
A
A
C
Genes: 6J2E62OO7DG

Composition

Labrador BK
18%
Pug
18%
Corgi
18%
Border Collie
9%
Shiba Inu
9%
German Shepard
9%
Beagle
9%
Boxer
9%

Current Energy

Vitality -34 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Border Collie
Legs Pug
Front Legs Shiba Inu
Head Labrador BK
Ears Pug
Snout Corgi
Mouth Corgi
Nose German Shepard
Eyes Beagle
Color Boxer