Nemo Nestle Bitcoin Dog - Mix of Labrador, Pug, Yorkshire Terrier, Schnauzer, Golder Retriever, Dachshund and Husky

Achievements

None
Nemo Nestle
Hello, I be Nemo Nestle. I keep my well-built figure with zeros and ones. I like never worrying about my dog poo. I've got people for that. I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).
  • Purity 9%
  • Age 33 days
  • Racing Exp 0
  • Labrador 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATACCAAGAGGACCAACACCAGAATTATTAGAA
A
T
A
C
C
A
A
G
A
G
G
A
C
C
A
A
C
A
C
C
A
G
A
A
T
T
A
T
T
A
G
A
A
Genes: C58A5452FF2

Composition

Labrador
27%
Pug
18%
Yorkshire Terrier
18%
Schnauzer
9%
Golder Retriever
9%
Dachshund
9%
Husky
9%

Current Energy

Vitality +6 points
Lunar Effect -4 points

Traits Breakdown

Body Schnauzer
Tail Labrador
Legs Golder Retriever
Front Legs Dachshund
Head Labrador
Ears Husky
Snout Labrador
Mouth Pug
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Pug

Parents

No Children