Munchkin Mariah Crypto Dog - Mix of Beagle, Labrador, Poodle, German Shepard, Boxer, Pitbull terrier, Yorkshire Terrier, Golder Retriever, Schnauzer and St. Bernard

Achievements

None
Munchkin Mariah
Greetings. My name is Munchkin Mariah. I've always wanted to be in commercials and be treated as the star I am! If you have fleas or ticks, don't bother. I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 1%
  • Age 34 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCACTAGACTCAAACTCCTTAAGAATATGACTA
C
C
A
C
T
A
G
A
C
T
C
A
A
A
C
T
C
C
T
T
A
A
G
A
A
T
A
T
G
A
C
T
A
Genes: 5DI7GNF8CBD

Composition

Beagle
18%
Labrador
9%
Poodle
9%
German Shepard
9%
Boxer
9%
Pitbull terrier
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Schnauzer
9%
St. Bernard
9%

Current Energy

Vitality +36 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Beagle
Legs Poodle
Front Legs German Shepard
Head Boxer
Ears Pitbull terrier
Snout Yorkshire Terrier
Mouth Golder Retriever
Nose Schnauzer
Eyes St. Bernard
Color Beagle

Parents

No Children