Odie Odin Crypto Dog - Mix of Schnauzer, Labrador, St. Bernard, Poodle, Pug, Pitbull terrier, Dachshund, Grey Wolf, Husky, Labrador BK and Golder Retriever

Achievements

Racer
Odie Odin
Greetings. My name is Odie Odin. I've always wanted to be in commercials and be treated as the star I am! If you have fleas or ticks, don't bother. I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 0%
  • Age 4 months
  • Racing Exp 15
  • Mixed-breed
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 0
2 races    Best Time16.55 sec
No rank  Racing *** Coins
100.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ATACCATGAGACGAATCCGGACCCACAGCAAGA
A
T
A
C
C
A
T
G
A
G
A
C
G
A
A
T
C
C
G
G
A
C
C
C
A
C
A
G
C
A
A
G
A
Genes: C5BI2NAL468

Composition

Schnauzer
9%
Labrador
9%
St. Bernard
9%
Poodle
9%
Pug
9%
Pitbull terrier
9%
Dachshund
9%
Grey Wolf
9%
Husky
9%
Labrador BK
9%
Golder Retriever
9%

Current Energy

Vitality -47 points
Lunar Effect -8 points

Traits Breakdown

Body Schnauzer
Tail Labrador
Legs St. Bernard
Front Legs Poodle
Head Pug
Ears Pitbull terrier
Snout Dachshund
Mouth Grey Wolf
Nose Husky
Eyes Labrador BK
Color Golder Retriever