Benji Bernard Bitcoin Dog - Mix of Beagle, Pug, Maltese, Corgi, Yorkshire Terrier, Golder Retriever, Pitbull terrier, Husky, Boxer, Labrador and German Shepard

Achievements

None
Benji Bernard
How do you do? I'm Benji Bernard. I'm having some new data architecture built for me, then I'd like to have you over to my place. Fences are just challenges...I don't let them stop me! I'm always up for a nice long walk around the neighborhood. If we can run as a pack for a while, I'm open to that.
  • Purity 0%
  • Age 4 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAGAAACCAGCTTAAGATCCACAAACCCATCA
C
T
A
G
A
A
A
C
C
A
G
C
T
T
A
A
G
A
T
C
C
A
C
A
A
A
C
C
C
A
T
C
A
Genes: D2KOF8N4G57

Composition

Beagle
9%
Pug
9%
Maltese
9%
Corgi
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Pitbull terrier
9%
Husky
9%
Boxer
9%
Labrador
9%
German Shepard
9%

Current Energy

Vitality -55 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Pug
Legs Maltese
Front Legs Corgi
Head Yorkshire Terrier
Ears Golder Retriever
Snout Pitbull terrier
Mouth Husky
Nose Boxer
Eyes Labrador
Color German Shepard