Koty Koko Bitcoin Dog - Mix of Labrador BK, Rottweiler, Yorkshire Terrier, French Bulldog, Maltese, St. Bernard, Corgi and Labrador

Achievements

None
Koty Koko
How do you do? I'm Koty Koko. I'm having some new data architecture built for me, then I'd like to have you over to my place. Fences are just challenges...I don't let them stop me! I'm always up for a nice long walk around the neighborhood. If we can run as a pack for a while, I'm open to that.
  • Purity 6%
  • Age 33 days
  • Racing Exp 0
  • Labrador BK 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTACGAACCGCATGAGCACACAGCGCACCACAC
T
T
A
C
G
A
A
C
C
G
C
A
T
G
A
G
C
A
C
A
C
A
G
C
G
C
A
C
C
A
C
A
C
Genes: F9K6B6HO65H

Composition

Labrador BK
27%
Rottweiler
18%
Yorkshire Terrier
9%
French Bulldog
9%
Maltese
9%
St. Bernard
9%
Corgi
9%
Labrador
9%

Current Energy

Vitality +13 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail French Bulldog
Legs Maltese
Front Legs Labrador BK
Head St. Bernard
Ears Labrador BK
Snout Rottweiler
Mouth Corgi
Nose Labrador BK
Eyes Labrador
Color Rottweiler