Mya Mackenzie Crypto Dog - Mix of Husky, Grey Wolf, Corgi, St. Bernard, German Shepard, Yorkshire Terrier, Beagle, Shiba Inu and Dachshund

Achievements

None
Mya Mackenzie
I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I hate hiding under the bed during a thunder storm but that's just smart, right? I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 5%
  • Age 31 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCTGATCATTACTAACACCCCCCACAGTAGGA
A
G
C
T
G
A
T
C
A
T
T
A
C
T
A
A
C
A
C
C
C
C
C
C
A
C
A
G
T
A
G
G
A
Genes: OB7FD4LL4EA

Composition

Husky
18%
Grey Wolf
18%
Corgi
9%
St. Bernard
9%
German Shepard
9%
Yorkshire Terrier
9%
Beagle
9%
Shiba Inu
9%
Dachshund
9%

Current Energy

Vitality +27 points
Lunar Effect +6 points

Traits Breakdown

Body Corgi
Tail St. Bernard
Legs German Shepard
Front Legs Yorkshire Terrier
Head Beagle
Ears Husky
Snout Grey Wolf
Mouth Grey Wolf
Nose Husky
Eyes Shiba Inu
Color Dachshund

Parents

No Children