Allie Airmail Crypto Dog - Mix of Labrador BK, Golder Retriever, Rottweiler, Shiba Inu, Grey Wolf, Schnauzer, St. Bernard, German Shepard, Labrador, Pitbull terrier and Maltese

Achievements

None
Allie Airmail
I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I hate hiding under the bed during a thunder storm but that's just smart, right? I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 0%
  • Age 4 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAGACACGTACCCATATGATCACCATCCACC
G
C
A
A
G
A
C
A
C
G
T
A
C
C
C
A
T
A
T
G
A
T
C
A
C
C
A
T
C
C
A
C
C
Genes: 68HELCB75NK

Composition

Labrador BK
9%
Golder Retriever
9%
Rottweiler
9%
Shiba Inu
9%
Grey Wolf
9%
Schnauzer
9%
St. Bernard
9%
German Shepard
9%
Labrador
9%
Pitbull terrier
9%
Maltese
9%

Current Energy

Vitality -28 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs Rottweiler
Front Legs Shiba Inu
Head Grey Wolf
Ears Schnauzer
Snout St. Bernard
Mouth German Shepard
Nose Labrador
Eyes Pitbull terrier
Color Maltese