Obi-Wan Obie Litecoin Dog - Mix of German Shepard, Corgi, Labrador BK, Pug and Border Collie

Achievements

None
Obi-Wan Obie
Barkjour mi amor! I'm Obi-Wan Obie. I hate hiding under the bed during a thunder storm but that's just smart, right? I live life by my favorite quote "Every dog has it's day", but every day is my day! I'm not looking to hook up forever, just to have a little fun.
  • Purity 24%
  • Age 4 months
  • Racing Exp 0
  • German Shepard 45%
  • 0 races
  • Gen 12
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGAATCATCATCAAGCTCATACAGCAGCTCA
G
C
A
G
A
A
T
C
A
T
C
A
T
C
A
A
G
C
T
C
A
T
A
C
A
G
C
A
G
C
T
C
A
Genes: 62777O7JOO7

Composition

German Shepard
45%
Corgi
27%
Labrador BK
9%
Pug
9%
Border Collie
9%

Current Energy

Vitality 0 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Corgi
Snout German Shepard
Mouth Border Collie
Nose Corgi
Eyes Corgi
Color German Shepard