Papa Pikachu Litecoin Dog - Mix of Yorkshire Terrier, Labrador BK, Poodle, Maltese, Rottweiler, Golder Retriever, Beagle and French Bulldog

Achievements

None
Papa Pikachu
Barkjour mi amor! I'm Papa Pikachu. I hate hiding under the bed during a thunder storm but that's just smart, right? I live life by my favorite quote "Every dog has it's day", but every day is my day! I'm not looking to hook up forever, just to have a little fun.
  • Purity 4%
  • Age 33 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCCACTTAGCAAGACTACGAGACTTAGACGCA
A
C
C
C
A
C
T
T
A
G
C
A
A
G
A
C
T
A
C
G
A
G
A
C
T
T
A
G
A
C
G
C
A
Genes: KHF68D9IFI6

Composition

Yorkshire Terrier
18%
Labrador BK
18%
Poodle
18%
Maltese
9%
Rottweiler
9%
Golder Retriever
9%
Beagle
9%
French Bulldog
9%

Current Energy

Vitality -1 points
Lunar Effect -10 points

Traits Breakdown

Body Maltese
Tail Rottweiler
Legs Yorkshire Terrier
Front Legs Labrador BK
Head Golder Retriever
Ears Beagle
Snout French Bulldog
Mouth Poodle
Nose Yorkshire Terrier
Eyes Poodle
Color Labrador BK

Parents

No Children