Chester Chrysler Litecoin Game Dog - Mix of German Shepard, Dachshund and Golder Retriever

Achievements

None
Chester Chrysler
You can call me Chester Chrysler, everybody else does. The cloud's my neighborhood. Fences are just challenges...I don't let them stop me! What's your favorite bed? Mine is the dirty laundry. My bark alone scares birds out of my yard. You scratch my belly and I'll scratch yours ;)
  • Purity 65%
  • Age 4 months
  • Racing Exp 0
  • German Shepard 82%
  • 0 races
  • Gen 22
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGGATCATCATCATCATCATCATCAAGATCA
T
C
A
G
G
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
A
G
A
T
C
A
Genes: 7A777777787

Composition

German Shepard
82%
Dachshund
9%
Golder Retriever
9%

Current Energy

Vitality 0 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes Golder Retriever
Color German Shepard