Piper Priscilla Litecoin Game Dog - Mix of German Shepard, Corgi, Maltese, Pug, Border Collie, Dachshund, Pitbull terrier and Yorkshire Terrier

Achievements

None
Piper Priscilla
You can call me Piper Priscilla, everybody else does. The cloud's my neighborhood. Fences are just challenges...I don't let them stop me! What's your favorite bed? Mine is the dirty laundry. My bark alone scares birds out of my yard. You scratch my belly and I'll scratch yours ;)
  • Purity 8%
  • Age 33 days
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCTCAACCGAATCATACGGATCATCCTTAAGC
A
G
C
T
C
A
A
C
C
G
A
A
T
C
A
T
A
C
G
G
A
T
C
A
T
C
C
T
T
A
A
G
C
Genes: O7K27JA7NFO

Composition

German Shepard
27%
Corgi
18%
Maltese
9%
Pug
9%
Border Collie
9%
Dachshund
9%
Pitbull terrier
9%
Yorkshire Terrier
9%

Current Energy

Vitality -5 points
Lunar Effect 0 points

Traits Breakdown

Body Corgi
Tail German Shepard
Legs Maltese
Front Legs Pug
Head German Shepard
Ears Border Collie
Snout Dachshund
Mouth German Shepard
Nose Pitbull terrier
Eyes Yorkshire Terrier
Color Corgi

Parents

No Children